Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: T18514.1
Subject Sequence ID: ENSG00000001626
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/T18514.1, 225 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000001626 (ENSG00000001626), 188699 bp

>gi|475322|gb|T18514.1|T18514 hbc2236 Human pancreatic islet Homo sapiens cDNA clone hbc2236 5', mRNA sequence
>ENSG00000001626

1-42  (115055-115096)   92% ->
43-80  (122864-122901)   100% ->
81-225  (123570-123713)   97%

      0     .    :    .    :    .    :    .    :    .    :
      1 ATTTTTGTGCTAATTTAATACTTAGTAATTTTTCTGGCAGAG        
        ||||||||||||||||  | ||||||||||||||||||||||>>>...>>
 115055 ATTTTTGTGCTAATTTGGTGCTTAGTAATTTTTCTGGCAGAGGTA...CA

     50     .    :    .    :    .    :    .    :    .    :
     43  GTGGCTGCTTCTTTGGTTGTGCTGTGGCTCCTTGGAAA         CA
        >||||||||||||||||||||||||||||||||||||||>>>...>>>||
 122863 GGTGGCTGCTTCTTTGGTTGTGCTGTGGCTCCTTGGAAAGTG...CAGCA

    100     .    :    .    :    .    :    .    :    .    :
     83 CTCCTTCTTCAAGACAAAGGGAATAGTACTCATAGTAGAAATAACAGCTA
        ||||-|||||||||||||||||||||||||||||||||||||||||||||
 123572 CTCC TCTTCAAGACAAAGGGAATAGTACTCATAGTAGAAATAACAGCTA

    150     .    :    .    :    .    :    .    :    .    :
    133 AGCAGTGATTATCACCAGCACCAGTTCGTATTATGTGTTTTACATTTACG
         |||||||||||||||||||||||||||||||||||||||||||||||||
 123621 TGCAGTGATTATCACCAGCACCAGTTCGTATTATGTGTTTTACATTTACG

    200     .    :    .    :    .    :    .    :
    183 TGGGAGTAGCCGACACTTT CGTTGCTATGGGATTCTTCAGAGG
        |||||||||||||||||||-|-||||||||||||||||||||||
 123671 TGGGAGTAGCCGACACTTTGC TTGCTATGGGATTCTTCAGAGG

END