Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: T27669.1
Subject Sequence ID: ENSG00000017427
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/T27669.1, 346 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000017427 (ENSG00000017427), 78292 bp

>gi|609767|gb|T27669.1|T27669 EST11722 Human Uterus Homo sapiens cDNA 5' end similar to insulin-like growth factor I (HT:641), mRNA sequence
>ENSG00000017427

(complement)

290-313  (3397-3417)   83%

      0     .    :    .    :
    290 CAGAAAATAAATGACTGGCCATTC
        ||||||||||||||||| ---|||
   3397 CAGAAAATAAATGACTGT   TTC

END