Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: T29359.1
Subject Sequence ID: ENSG00000001626
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/T29359.1, 243 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000001626 (ENSG00000001626), 188699 bp

>gi|611457|gb|T29359.1|T29359 EST78297 Human Pancreas Homo sapiens cDNA 5' end similar to cystic fibrosis transmembrane conductance regulator (HT:2294), mRNA sequence
>ENSG00000001626

1-243  (187880-188120)   98%

      0     .    :    .    :    .    :    .    :    .    :
      1 CTTTCACAGGGGACAGGATGGTTCCNTTGATGAAGAAGTTGATATGCCTT
        ||||||||||||||||||||||||| ||||||||||||||||||||||||
 187880 CTTTCACAGGGGACAGGATGGTTCCCTTGATGAAGAAGTTGATATGCCTT

     50     .    :    .    :    .    :    .    :    .    :
     51 TNCCCAACTCCAGAAAGTGACAAGCTCACAGACCTTTGAACTAGAGTTTA
        | ||||||||||||||||||||||||||||||||||||||||||||||||
 187930 TTCCCAACTCCAGAAAGTGACAAGCTCACAGACCTTTGAACTAGAGTTTA

    100     .    :    .    :    .    :    .    :    .    :
    101 GCTGGAAAAGTATGTTAGTGCAAATTGTCACAGGACAGCCCTTCTTTCCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187980 GCTGGAAAAGTATGTTAGTGCAAATTGTCACAGGACAGCCCTTCTTTCCA

    150     .    :    .    :    .    :    .    :    .    :
    151 CAGAAGCTCCAGGTAGAGGGTGTGTAAGTAGATAGGCCATGGGCACTGTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 188030 CAGAAGCTCCAGGTAGAGGGTGTGTAAGTAGATAGGCCATGGGCACTGTG

    200     .    :    .    :    .    :    .    :
    201 GGTAGACACACATGAAGTCCAAGCATTTAGATGTATAGGTTNT
        |||||||||||||||||||||||||||||||||||||||||--
 188080 GGTAGACACACATGAAGTCCAAGCATTTAGATGTATAGGTT  

END