Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: U14680.1
Subject Sequence ID: ENSG00000012048
Subject Sequence type: 2


seq1 = /RAID/mart2/Splice/web_temp/fasta/U14680.1, 5711 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000012048 (ENSG00000012048), 81091 bp

>gi|555931|gb|U14680.1|HSU14680 Homo sapiens breast and ovarian cancer susceptibility (BRCA1) mRNA, complete cds
>ENSG00000012048

(complement)

1-100  (23-121)   95% ->
101-199  (1277-1375)   100% ->
200-253  (9613-9666)   100% ->
254-331  (18859-18936)   100% ->
332-420  (20436-20524)   100% ->
421-560  (21131-21270)   100% ->
561-666  (25512-25617)   100% ->
667-712  (28103-28148)   100% ->
713-789  (29470-29546)   100% ->
790-4215  (30532-33957)   100% ->
4216-4304  (34360-34448)   100% ->
4305-4476  (42817-42988)   100% ->
4477-4603  (48778-48904)   100% ->
4604-4794  (50871-51061)   100% ->
4795-5105  (54154-54464)   100% ->
5106-5193  (57697-57784)   100% ->
5194-5271  (61441-61518)   100% ->
5272-5312  (62019-62059)   100% ->
5313-5396  (68257-68340)   100% ->
5397-5451  (74275-74329)   100% ->
5452-5525  (76198-76271)   100% ->
5526-5586  (77689-77749)   100% ->
5587-5711  (79590-79714)   100%

      0     .    :    .    :    .    :    .    :    .    :
      1 AGCTCGCTGAGACTTCCTGGACCCCGCACCAGGCTGTGGGGTTTCTCAGA
        ||||||||||||||||||||||   | ||-||||||||||||||||||||
     23 AGCTCGCTGAGACTTCCTGGACGGGGGAC AGGCTGTGGGGTTTCTCAGA

     50     .    :    .    :    .    :    .    :    .    :
     51 TAACTGGGCCCCTGCGCTCAGGAGGCCTTCACCCTCTGCTCTGGGTAAAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
     72 TAACTGGGCCCCTGCGCTCAGGAGGCCTTCACCCTCTGCTCTGGGTAAAG

    100     .    :    .    :    .    :    .    :    .    :
    101          TTCATTGGAACAGAAAGAAATGGATTTATCTGCTCTTCGCG
        >>>...>>>|||||||||||||||||||||||||||||||||||||||||
    122 GTA...AAGTTCATTGGAACAGAAAGAAATGGATTTATCTGCTCTTCGCG

    150     .    :    .    :    .    :    .    :    .    :
    142 TTGAAGAAGTACAAAATGTCATTAATGCTATGCAGAAAATCTTAGAGTGT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   1318 TTGAAGAAGTACAAAATGTCATTAATGCTATGCAGAAAATCTTAGAGTGT

    200     .    :    .    :    .    :    .    :    .    :
    192 CCCATCTG         TCTGGAGTTGATCAAGGAACCTGTCTCCACAAA
        ||||||||>>>...>>>|||||||||||||||||||||||||||||||||
   1368 CCCATCTGGTA...TAGTCTGGAGTTGATCAAGGAACCTGTCTCCACAAA

    250     .    :    .    :    .    :    .    :    .    :
    233 GTGTGACCACATATTTTGCAA         ATTTTGCATGCTGAAACTTC
        |||||||||||||||||||||>>>...>>>||||||||||||||||||||
   9646 GTGTGACCACATATTTTGCAAGTA...TAGATTTTGCATGCTGAAACTTC

    300     .    :    .    :    .    :    .    :    .    :
    274 TCAACCAGAAGAAAGGGCCTTCACAGTGTCCTTTATGTAAGAATGATATA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  18879 TCAACCAGAAGAAAGGGCCTTCACAGTGTCCTTTATGTAAGAATGATATA

    350     .    :    .    :    .    :    .    :    .    :
    324 ACCAAAAG         GAGCCTACAAGAAAGTACGAGATTTAGTCAACT
        ||||||||>>>...>>>|||||||||||||||||||||||||||||||||
  18929 ACCAAAAGGTA...CAGGAGCCTACAAGAAAGTACGAGATTTAGTCAACT

    400     .    :    .    :    .    :    .    :    .    :
    365 TGTTGAAGAGCTATTGAAAATCATTTGTGCTTTTCAGCTTGACACAGGTT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  20469 TGTTGAAGAGCTATTGAAAATCATTTGTGCTTTTCAGCTTGACACAGGTT

    450     .    :    .    :    .    :    .    :    .    :
    415 TGGAGT         ATGCAAACAGCTATAATTTTGCAAAAAAGGAAAAT
        ||||||>>>...>>>|||||||||||||||||||||||||||||||||||
  20519 TGGAGTGTA...CAGATGCAAACAGCTATAATTTTGCAAAAAAGGAAAAT

    500     .    :    .    :    .    :    .    :    .    :
    456 AACTCTCCTGAACATCTAAAAGATGAAGTTTCTATCATCCAAAGTATGGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  21166 AACTCTCCTGAACATCTAAAAGATGAAGTTTCTATCATCCAAAGTATGGG

    550     .    :    .    :    .    :    .    :    .    :
    506 CTACAGAAACCGTGCCAAAAGACTTCTACAGAGTGAACCCGAAAATCCTT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  21216 CTACAGAAACCGTGCCAAAAGACTTCTACAGAGTGAACCCGAAAATCCTT

    600     .    :    .    :    .    :    .    :    .    :
    556 CCTTG         CAGGAAACCAGTCTCAGTGTCCAACTCTCTAACCTT
        |||||>>>...>>>||||||||||||||||||||||||||||||||||||
  21266 CCTTGGTA...TAGCAGGAAACCAGTCTCAGTGTCCAACTCTCTAACCTT

    650     .    :    .    :    .    :    .    :    .    :
    597 GGAACTGTGAGAACTCTGAGGACAAAGCAGCGGATACAACCTCAAAAGAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  25548 GGAACTGTGAGAACTCTGAGGACAAAGCAGCGGATACAACCTCAAAAGAC

    700     .    :    .    :    .    :    .    :    .    :
    647 GTCTGTCTACATTGAATTGG         GATCTGATTCTTCTGAAGATA
        ||||||||||||||||||||>>>...>>>|||||||||||||||||||||
  25598 GTCTGTCTACATTGAATTGGGTA...TAGGATCTGATTCTTCTGAAGATA

    750     .    :    .    :    .    :    .    :    .    :
    688 CCGTTAATAAGGCAACTTATTGCAG         TGTGGGAGATCAAGAA
        |||||||||||||||||||||||||>>>...>>>||||||||||||||||
  28124 CCGTTAATAAGGCAACTTATTGCAGGTG...TAGTGTGGGAGATCAAGAA

    800     .    :    .    :    .    :    .    :    .    :
    729 TTGTTACAAATCACCCCTCAAGGAACCAGGGATGAAATCAGTTTGGATTC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  29486 TTGTTACAAATCACCCCTCAAGGAACCAGGGATGAAATCAGTTTGGATTC

    850     .    :    .    :    .    :    .    :    .    :
    779 TGCAAAAAAGG         CTGCTTGTGAATTTTCTGAGACGGATGTAA
        |||||||||||>>>...>>>||||||||||||||||||||||||||||||
  29536 TGCAAAAAAGGGTA...CAGCTGCTTGTGAATTTTCTGAGACGGATGTAA

    900     .    :    .    :    .    :    .    :    .    :
    820 CAAATACTGAACATCATCAACCCAGTAATAATGATTTGAACACCACTGAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  30562 CAAATACTGAACATCATCAACCCAGTAATAATGATTTGAACACCACTGAG

    950     .    :    .    :    .    :    .    :    .    :
    870 AAGCGTGCAGCTGAGAGGCATCCAGAAAAGTATCAGGGTAGTTCTGTTTC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  30612 AAGCGTGCAGCTGAGAGGCATCCAGAAAAGTATCAGGGTAGTTCTGTTTC

   1000     .    :    .    :    .    :    .    :    .    :
    920 AAACTTGCATGTGGAGCCATGTGGCACAAATACTCATGCCAGCTCATTAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  30662 AAACTTGCATGTGGAGCCATGTGGCACAAATACTCATGCCAGCTCATTAC

   1050     .    :    .    :    .    :    .    :    .    :
    970 AGCATGAGAACAGCAGTTTATTACTCACTAAAGACAGAATGAATGTAGAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  30712 AGCATGAGAACAGCAGTTTATTACTCACTAAAGACAGAATGAATGTAGAA

   1100     .    :    .    :    .    :    .    :    .    :
   1020 AAGGCTGAATTCTGTAATAAAAGCAAACAGCCTGGCTTAGCAAGGAGCCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  30762 AAGGCTGAATTCTGTAATAAAAGCAAACAGCCTGGCTTAGCAAGGAGCCA

   1150     .    :    .    :    .    :    .    :    .    :
   1070 ACATAACAGATGGGCTGGAAGTAAGGAAACATGTAATGATAGGCGGACTC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  30812 ACATAACAGATGGGCTGGAAGTAAGGAAACATGTAATGATAGGCGGACTC

   1200     .    :    .    :    .    :    .    :    .    :
   1120 CCAGCACAGAAAAAAAGGTAGATCTGAATGCTGATCCCCTGTGTGAGAGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  30862 CCAGCACAGAAAAAAAGGTAGATCTGAATGCTGATCCCCTGTGTGAGAGA

   1250     .    :    .    :    .    :    .    :    .    :
   1170 AAAGAATGGAATAAGCAGAAACTGCCATGCTCAGAGAATCCTAGAGATAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  30912 AAAGAATGGAATAAGCAGAAACTGCCATGCTCAGAGAATCCTAGAGATAC

   1300     .    :    .    :    .    :    .    :    .    :
   1220 TGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGAAAGTTAATG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  30962 TGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGAAAGTTAATG

   1350     .    :    .    :    .    :    .    :    .    :
   1270 AGTGGTTTTCCAGAAGTGATGAACTGTTAGGTTCTGATGACTCACATGAT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  31012 AGTGGTTTTCCAGAAGTGATGAACTGTTAGGTTCTGATGACTCACATGAT

   1400     .    :    .    :    .    :    .    :    .    :
   1320 GGGGAGTCTGAATCAAATGCCAAAGTAGCTGATGTATTGGACGTTCTAAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  31062 GGGGAGTCTGAATCAAATGCCAAAGTAGCTGATGTATTGGACGTTCTAAA

   1450     .    :    .    :    .    :    .    :    .    :
   1370 TGAGGTAGATGAATATTCTGGTTCTTCAGAGAAAATAGACTTACTGGCCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  31112 TGAGGTAGATGAATATTCTGGTTCTTCAGAGAAAATAGACTTACTGGCCA

   1500     .    :    .    :    .    :    .    :    .    :
   1420 GTGATCCTCATGAGGCTTTAATATGTAAAAGTGAAAGAGTTCACTCCAAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  31162 GTGATCCTCATGAGGCTTTAATATGTAAAAGTGAAAGAGTTCACTCCAAA

   1550     .    :    .    :    .    :    .    :    .    :
   1470 TCAGTAGAGAGTAATATTGAAGACAAAATATTTGGGAAAACCTATCGGAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  31212 TCAGTAGAGAGTAATATTGAAGACAAAATATTTGGGAAAACCTATCGGAA

   1600     .    :    .    :    .    :    .    :    .    :
   1520 GAAGGCAAGCCTCCCCAACTTAAGCCATGTAACTGAAAATCTAATTATAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  31262 GAAGGCAAGCCTCCCCAACTTAAGCCATGTAACTGAAAATCTAATTATAG

   1650     .    :    .    :    .    :    .    :    .    :
   1570 GAGCATTTGTTACTGAGCCACAGATAATACAAGAGCGTCCCCTCACAAAT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  31312 GAGCATTTGTTACTGAGCCACAGATAATACAAGAGCGTCCCCTCACAAAT

   1700     .    :    .    :    .    :    .    :    .    :
   1620 AAATTAAAGCGTAAAAGGAGACCTACATCAGGCCTTCATCCTGAGGATTT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  31362 AAATTAAAGCGTAAAAGGAGACCTACATCAGGCCTTCATCCTGAGGATTT

   1750     .    :    .    :    .    :    .    :    .    :
   1670 TATCAAGAAAGCAGATTTGGCAGTTCAAAAGACTCCTGAAATGATAAATC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  31412 TATCAAGAAAGCAGATTTGGCAGTTCAAAAGACTCCTGAAATGATAAATC

   1800     .    :    .    :    .    :    .    :    .    :
   1720 AGGGAACTAACCAAACGGAGCAGAATGGTCAAGTGATGAATATTACTAAT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  31462 AGGGAACTAACCAAACGGAGCAGAATGGTCAAGTGATGAATATTACTAAT

   1850     .    :    .    :    .    :    .    :    .    :
   1770 AGTGGTCATGAGAATAAAACAAAAGGTGATTCTATTCAGAATGAGAAAAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  31512 AGTGGTCATGAGAATAAAACAAAAGGTGATTCTATTCAGAATGAGAAAAA

   1900     .    :    .    :    .    :    .    :    .    :
   1820 TCCTAACCCAATAGAATCACTCGAAAAAGAATCTGCTTTCAAAACGAAAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  31562 TCCTAACCCAATAGAATCACTCGAAAAAGAATCTGCTTTCAAAACGAAAG

   1950     .    :    .    :    .    :    .    :    .    :
   1870 CTGAACCTATAAGCAGCAGTATAAGCAATATGGAACTCGAATTAAATATC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  31612 CTGAACCTATAAGCAGCAGTATAAGCAATATGGAACTCGAATTAAATATC

   2000     .    :    .    :    .    :    .    :    .    :
   1920 CACAATTCAAAAGCACCTAAAAAGAATAGGCTGAGGAGGAAGTCTTCTAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  31662 CACAATTCAAAAGCACCTAAAAAGAATAGGCTGAGGAGGAAGTCTTCTAC

   2050     .    :    .    :    .    :    .    :    .    :
   1970 CAGGCATATTCATGCGCTTGAACTAGTAGTCAGTAGAAATCTAAGCCCAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  31712 CAGGCATATTCATGCGCTTGAACTAGTAGTCAGTAGAAATCTAAGCCCAC

   2100     .    :    .    :    .    :    .    :    .    :
   2020 CTAATTGTACTGAATTGCAAATTGATAGTTGTTCTAGCAGTGAAGAGATA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  31762 CTAATTGTACTGAATTGCAAATTGATAGTTGTTCTAGCAGTGAAGAGATA

   2150     .    :    .    :    .    :    .    :    .    :
   2070 AAGAAAAAAAAGTACAACCAAATGCCAGTCAGGCACAGCAGAAACCTACA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  31812 AAGAAAAAAAAGTACAACCAAATGCCAGTCAGGCACAGCAGAAACCTACA

   2200     .    :    .    :    .    :    .    :    .    :
   2120 ACTCATGGAAGGTAAAGAACCTGCAACTGGAGCCAAGAAGAGTAACAAGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  31862 ACTCATGGAAGGTAAAGAACCTGCAACTGGAGCCAAGAAGAGTAACAAGC

   2250     .    :    .    :    .    :    .    :    .    :
   2170 CAAATGAACAGACAAGTAAAAGACATGACAGCGATACTTTCCCAGAGCTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  31912 CAAATGAACAGACAAGTAAAAGACATGACAGCGATACTTTCCCAGAGCTG

   2300     .    :    .    :    .    :    .    :    .    :
   2220 AAGTTAACAAATGCACCTGGTTCTTTTACTAAGTGTTCAAATACCAGTGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  31962 AAGTTAACAAATGCACCTGGTTCTTTTACTAAGTGTTCAAATACCAGTGA

   2350     .    :    .    :    .    :    .    :    .    :
   2270 ACTTAAAGAATTTGTCAATCCTAGCCTTCCAAGAGAAGAAAAAGAAGAGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  32012 ACTTAAAGAATTTGTCAATCCTAGCCTTCCAAGAGAAGAAAAAGAAGAGA

   2400     .    :    .    :    .    :    .    :    .    :
   2320 AACTAGAAACAGTTAAAGTGTCTAATAATGCTGAAGACCCCAAAGATCTC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  32062 AACTAGAAACAGTTAAAGTGTCTAATAATGCTGAAGACCCCAAAGATCTC

   2450     .    :    .    :    .    :    .    :    .    :
   2370 ATGTTAAGTGGAGAAAGGGTTTTGCAAACTGAAAGATCTGTAGAGAGTAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  32112 ATGTTAAGTGGAGAAAGGGTTTTGCAAACTGAAAGATCTGTAGAGAGTAG

   2500     .    :    .    :    .    :    .    :    .    :
   2420 CAGTATTTCATTGGTACCTGGTACTGATTATGGCACTCAGGAAAGTATCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  32162 CAGTATTTCATTGGTACCTGGTACTGATTATGGCACTCAGGAAAGTATCT

   2550     .    :    .    :    .    :    .    :    .    :
   2470 CGTTACTGGAAGTTAGCACTCTAGGGAAGGCAAAAACAGAACCAAATAAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  32212 CGTTACTGGAAGTTAGCACTCTAGGGAAGGCAAAAACAGAACCAAATAAA

   2600     .    :    .    :    .    :    .    :    .    :
   2520 TGTGTGAGTCAGTGTGCAGCATTTGAAAACCCCAAGGGACTAATTCATGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  32262 TGTGTGAGTCAGTGTGCAGCATTTGAAAACCCCAAGGGACTAATTCATGG

   2650     .    :    .    :    .    :    .    :    .    :
   2570 TTGTTCCAAAGATAATAGAAATGACACAGAAGGCTTTAAGTATCCATTGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  32312 TTGTTCCAAAGATAATAGAAATGACACAGAAGGCTTTAAGTATCCATTGG

   2700     .    :    .    :    .    :    .    :    .    :
   2620 GACATGAAGTTAACCACAGTCGGGAAACAAGCATAGAAATGGAAGAAAGT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  32362 GACATGAAGTTAACCACAGTCGGGAAACAAGCATAGAAATGGAAGAAAGT

   2750     .    :    .    :    .    :    .    :    .    :
   2670 GAACTTGATGCTCAGTATTTGCAGAATACATTCAAGGTTTCAAAGCGCCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  32412 GAACTTGATGCTCAGTATTTGCAGAATACATTCAAGGTTTCAAAGCGCCA

   2800     .    :    .    :    .    :    .    :    .    :
   2720 GTCATTTGCTCCGTTTTCAAATCCAGGAAATGCAGAAGAGGAATGTGCAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  32462 GTCATTTGCTCCGTTTTCAAATCCAGGAAATGCAGAAGAGGAATGTGCAA

   2850     .    :    .    :    .    :    .    :    .    :
   2770 CATTCTCTGCCCACTCTGGGTCCTTAAAGAAACAAAGTCCAAAAGTCACT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  32512 CATTCTCTGCCCACTCTGGGTCCTTAAAGAAACAAAGTCCAAAAGTCACT

   2900     .    :    .    :    .    :    .    :    .    :
   2820 TTTGAATGTGAACAAAAGGAAGAAAATCAAGGAAAGAATGAGTCTAATAT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  32562 TTTGAATGTGAACAAAAGGAAGAAAATCAAGGAAAGAATGAGTCTAATAT

   2950     .    :    .    :    .    :    .    :    .    :
   2870 CAAGCCTGTACAGACAGTTAATATCACTGCAGGCTTTCCTGTGGTTGGTC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  32612 CAAGCCTGTACAGACAGTTAATATCACTGCAGGCTTTCCTGTGGTTGGTC

   3000     .    :    .    :    .    :    .    :    .    :
   2920 AGAAAGATAAGCCAGTTGATAATGCCAAATGTAGTATCAAAGGAGGCTCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  32662 AGAAAGATAAGCCAGTTGATAATGCCAAATGTAGTATCAAAGGAGGCTCT

   3050     .    :    .    :    .    :    .    :    .    :
   2970 AGGTTTTGTCTATCATCTCAGTTCAGAGGCAACGAAACTGGACTCATTAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  32712 AGGTTTTGTCTATCATCTCAGTTCAGAGGCAACGAAACTGGACTCATTAC

   3100     .    :    .    :    .    :    .    :    .    :
   3020 TCCAAATAAACATGGACTTTTACAAAACCCATATCGTATACCACCACTTT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  32762 TCCAAATAAACATGGACTTTTACAAAACCCATATCGTATACCACCACTTT

   3150     .    :    .    :    .    :    .    :    .    :
   3070 TTCCCATCAAGTCATTTGTTAAAACTAAATGTAAGAAAAATCTGCTAGAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  32812 TTCCCATCAAGTCATTTGTTAAAACTAAATGTAAGAAAAATCTGCTAGAG

   3200     .    :    .    :    .    :    .    :    .    :
   3120 GAAAACTTTGAGGAACATTCAATGTCACCTGAAAGAGAAATGGGAAATGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  32862 GAAAACTTTGAGGAACATTCAATGTCACCTGAAAGAGAAATGGGAAATGA

   3250     .    :    .    :    .    :    .    :    .    :
   3170 GAACATTCCAAGTACAGTGAGCACAATTAGCCGTAATAACATTAGAGAAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  32912 GAACATTCCAAGTACAGTGAGCACAATTAGCCGTAATAACATTAGAGAAA

   3300     .    :    .    :    .    :    .    :    .    :
   3220 ATGTTTTTAAAGAAGCCAGCTCAAGCAATATTAATGAAGTAGGTTCCAGT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  32962 ATGTTTTTAAAGAAGCCAGCTCAAGCAATATTAATGAAGTAGGTTCCAGT

   3350     .    :    .    :    .    :    .    :    .    :
   3270 ACTAATGAAGTGGGCTCCAGTATTAATGAAATAGGTTCCAGTGATGAAAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  33012 ACTAATGAAGTGGGCTCCAGTATTAATGAAATAGGTTCCAGTGATGAAAA

   3400     .    :    .    :    .    :    .    :    .    :
   3320 CATTCAAGCAGAACTAGGTAGAAACAGAGGGCCAAAATTGAATGCTATGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  33062 CATTCAAGCAGAACTAGGTAGAAACAGAGGGCCAAAATTGAATGCTATGC

   3450     .    :    .    :    .    :    .    :    .    :
   3370 TTAGATTAGGGGTTTTGCAACCTGAGGTCTATAAACAAAGTCTTCCTGGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  33112 TTAGATTAGGGGTTTTGCAACCTGAGGTCTATAAACAAAGTCTTCCTGGA

   3500     .    :    .    :    .    :    .    :    .    :
   3420 AGTAATTGTAAGCATCCTGAAATAAAAAAGCAAGAATATGAAGAAGTAGT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  33162 AGTAATTGTAAGCATCCTGAAATAAAAAAGCAAGAATATGAAGAAGTAGT

   3550     .    :    .    :    .    :    .    :    .    :
   3470 TCAGACTGTTAATACAGATTTCTCTCCATATCTGATTTCAGATAACTTAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  33212 TCAGACTGTTAATACAGATTTCTCTCCATATCTGATTTCAGATAACTTAG

   3600     .    :    .    :    .    :    .    :    .    :
   3520 AACAGCCTATGGGAAGTAGTCATGCATCTCAGGTTTGTTCTGAGACACCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  33262 AACAGCCTATGGGAAGTAGTCATGCATCTCAGGTTTGTTCTGAGACACCT

   3650     .    :    .    :    .    :    .    :    .    :
   3570 GATGACCTGTTAGATGATGGTGAAATAAAGGAAGATACTAGTTTTGCTGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  33312 GATGACCTGTTAGATGATGGTGAAATAAAGGAAGATACTAGTTTTGCTGA

   3700     .    :    .    :    .    :    .    :    .    :
   3620 AAATGACATTAAGGAAAGTTCTGCTGTTTTTAGCAAAAGCGTCCAGAAAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  33362 AAATGACATTAAGGAAAGTTCTGCTGTTTTTAGCAAAAGCGTCCAGAAAG

   3750     .    :    .    :    .    :    .    :    .    :
   3670 GAGAGCTTAGCAGGAGTCCTAGCCCTTTCACCCATACACATTTGGCTCAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  33412 GAGAGCTTAGCAGGAGTCCTAGCCCTTTCACCCATACACATTTGGCTCAG

   3800     .    :    .    :    .    :    .    :    .    :
   3720 GGTTACCGAAGAGGGGCCAAGAAATTAGAGTCCTCAGAAGAGAACTTATC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  33462 GGTTACCGAAGAGGGGCCAAGAAATTAGAGTCCTCAGAAGAGAACTTATC

   3850     .    :    .    :    .    :    .    :    .    :
   3770 TAGTGAGGATGAAGAGCTTCCCTGCTTCCAACACTTGTTATTTGGTAAAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  33512 TAGTGAGGATGAAGAGCTTCCCTGCTTCCAACACTTGTTATTTGGTAAAG

   3900     .    :    .    :    .    :    .    :    .    :
   3820 TAAACAATATACCTTCTCAGTCTACTAGGCATAGCACCGTTGCTACCGAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  33562 TAAACAATATACCTTCTCAGTCTACTAGGCATAGCACCGTTGCTACCGAG

   3950     .    :    .    :    .    :    .    :    .    :
   3870 TGTCTGTCTAAGAACACAGAGGAGAATTTATTATCATTGAAGAATAGCTT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  33612 TGTCTGTCTAAGAACACAGAGGAGAATTTATTATCATTGAAGAATAGCTT

   4000     .    :    .    :    .    :    .    :    .    :
   3920 AAATGACTGCAGTAACCAGGTAATATTGGCAAAGGCATCTCAGGAACATC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  33662 AAATGACTGCAGTAACCAGGTAATATTGGCAAAGGCATCTCAGGAACATC

   4050     .    :    .    :    .    :    .    :    .    :
   3970 ACCTTAGTGAGGAAACAAAATGTTCTGCTAGCTTGTTTTCTTCACAGTGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  33712 ACCTTAGTGAGGAAACAAAATGTTCTGCTAGCTTGTTTTCTTCACAGTGC

   4100     .    :    .    :    .    :    .    :    .    :
   4020 AGTGAATTGGAAGACTTGACTGCAAATACAAACACCCAGGATCCTTTCTT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  33762 AGTGAATTGGAAGACTTGACTGCAAATACAAACACCCAGGATCCTTTCTT

   4150     .    :    .    :    .    :    .    :    .    :
   4070 GATTGGTTCTTCCAAACAAATGAGGCATCAGTCTGAAAGCCAGGGAGTTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  33812 GATTGGTTCTTCCAAACAAATGAGGCATCAGTCTGAAAGCCAGGGAGTTG

   4200     .    :    .    :    .    :    .    :    .    :
   4120 GTCTGAGTGACAAGGAATTGGTTTCAGATGATGAAGAAAGAGGAACGGGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  33862 GTCTGAGTGACAAGGAATTGGTTTCAGATGATGAAGAAAGAGGAACGGGC

   4250     .    :    .    :    .    :    .    :    .    :
   4170 TTGGAAGAAAATAATCAAGAAGAGCAAAGCATGGATTCAAACTTAG    
        ||||||||||||||||||||||||||||||||||||||||||||||>>>.
  33912 TTGGAAGAAAATAATCAAGAAGAGCAAAGCATGGATTCAAACTTAGGTA.

   4300     .    :    .    :    .    :    .    :    .    :
   4216      GTGAAGCAGCATCTGGGTGTGAGAGTGAAACAAGCGTCTCTGAAG
        ..>>>|||||||||||||||||||||||||||||||||||||||||||||
  33962 ..AAGGTGAAGCAGCATCTGGGTGTGAGAGTGAAACAAGCGTCTCTGAAG

   4350     .    :    .    :    .    :    .    :    .    :
   4261 ACTGCTCAGGGCTATCCTCTCAGAGTGACATTTTAACCACTCAG      
        ||||||||||||||||||||||||||||||||||||||||||||>>>...
  34405 ACTGCTCAGGGCTATCCTCTCAGAGTGACATTTTAACCACTCAGGTA...

   4400     .    :    .    :    .    :    .    :    .    :
   4305    CAGAGGGATACCATGCAACATAACCTGATAAAGCTCCAGCAGGAAAT
        >>>|||||||||||||||||||||||||||||||||||||||||||||||
  42814 AAGCAGAGGGATACCATGCAACATAACCTGATAAAGCTCCAGCAGGAAAT

   4450     .    :    .    :    .    :    .    :    .    :
   4352 GGCTGAACTAGAAGCTGTGTTAGAACAGCATGGGAGCCAGCCTTCTAACA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  42864 GGCTGAACTAGAAGCTGTGTTAGAACAGCATGGGAGCCAGCCTTCTAACA

   4500     .    :    .    :    .    :    .    :    .    :
   4402 GCTACCCTTCCATCATAAGTGACTCTTCTGCCCTTGAGGACCTGCGAAAT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  42914 GCTACCCTTCCATCATAAGTGACTCTTCTGCCCTTGAGGACCTGCGAAAT

   4550     .    :    .    :    .    :    .    :    .    :
   4452 CCAGAACAAAGCACATCAGAAAAAG         CAGTATTAACTTCACA
        |||||||||||||||||||||||||>>>...>>>||||||||||||||||
  42964 CCAGAACAAAGCACATCAGAAAAAGGTG...AAGCAGTATTAACTTCACA

   4600     .    :    .    :    .    :    .    :    .    :
   4493 GAAAAGTAGTGAATACCCTATAAGCCAGAATCCAGAAGGCCTTTCTGCTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  48794 GAAAAGTAGTGAATACCCTATAAGCCAGAATCCAGAAGGCCTTTCTGCTG

   4650     .    :    .    :    .    :    .    :    .    :
   4543 ACAAGTTTGAGGTGTCTGCAGATAGTTCTACCAGTAAAAATAAAGAACCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  48844 ACAAGTTTGAGGTGTCTGCAGATAGTTCTACCAGTAAAAATAAAGAACCA

   4700     .    :    .    :    .    :    .    :    .    :
   4593 GGAGTGGAAAG         GTCATCCCCTTCTAAATGCCCATCATTAGA
        |||||||||||>>>...>>>||||||||||||||||||||||||||||||
  48894 GGAGTGGAAAGGTA...TAGGTCATCCCCTTCTAAATGCCCATCATTAGA

   4750     .    :    .    :    .    :    .    :    .    :
   4634 TGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAGAATAGAAACT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  50901 TGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAGAATAGAAACT

   4800     .    :    .    :    .    :    .    :    .    :
   4684 ACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGCAACAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  50951 ACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGCAACAG

   4850     .    :    .    :    .    :    .    :    .    :
   4734 CTGGAAGAGTCTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  51001 CTGGAAGAGTCTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAG

   4900     .    :    .    :    .    :    .    :    .    :
   4784 GCAAGATCTAG         AGGGAACCCCTTACCTGGAATCTGGAATCA
        |||||||||||>>>...>>>||||||||||||||||||||||||||||||
  51051 GCAAGATCTAGGTA...CAGAGGGAACCCCTTACCTGGAATCTGGAATCA

   4950     .    :    .    :    .    :    .    :    .    :
   4825 GCCTCTTCTCTGATGACCCTGAATCTGATCCTTCTGAAGACAGAGCCCCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  54184 GCCTCTTCTCTGATGACCCTGAATCTGATCCTTCTGAAGACAGAGCCCCA

   5000     .    :    .    :    .    :    .    :    .    :
   4875 GAGTCAGCTCGTGTTGGCAACATACCATCTTCAACCTCTGCATTGAAAGT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  54234 GAGTCAGCTCGTGTTGGCAACATACCATCTTCAACCTCTGCATTGAAAGT

   5050     .    :    .    :    .    :    .    :    .    :
   4925 TCCCCAATTGAAAGTTGCAGAATCTGCCCAGAGTCCAGCTGCTGCTCATA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  54284 TCCCCAATTGAAAGTTGCAGAATCTGCCCAGAGTCCAGCTGCTGCTCATA

   5100     .    :    .    :    .    :    .    :    .    :
   4975 CTACTGATACTGCTGGGTATAATGCAATGGAAGAAAGTGTGAGCAGGGAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  54334 CTACTGATACTGCTGGGTATAATGCAATGGAAGAAAGTGTGAGCAGGGAG

   5150     .    :    .    :    .    :    .    :    .    :
   5025 AAGCCAGAATTGACAGCTTCAACAGAAAGGGTCAACAAAAGAATGTCCAT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  54384 AAGCCAGAATTGACAGCTTCAACAGAAAGGGTCAACAAAAGAATGTCCAT

   5200     .    :    .    :    .    :    .    :    .    :
   5075 GGTGGTGTCTGGCCTGACCCCAGAAGAATTT         ATGCTCGTGT
        |||||||||||||||||||||||||||||||>>>...>>>||||||||||
  54434 GGTGGTGTCTGGCCTGACCCCAGAAGAATTTGTG...CAGATGCTCGTGT

   5250     .    :    .    :    .    :    .    :    .    :
   5116 ACAAGTTTGCCAGAAAACACCACATCACTTTAACTAATCTAATTACTGAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  57707 ACAAGTTTGCCAGAAAACACCACATCACTTTAACTAATCTAATTACTGAA

   5300     .    :    .    :    .    :    .    :    .    :
   5166 GAGACTACTCATGTTGTTATGAAAACAG         ATGCTGAGTTTGT
        ||||||||||||||||||||||||||||>>>...>>>|||||||||||||
  57757 GAGACTACTCATGTTGTTATGAAAACAGGTA...CAGATGCTGAGTTTGT

   5350     .    :    .    :    .    :    .    :    .    :
   5207 GTGTGAACGGACACTGAAATATTTTCTAGGAATTGCGGGAGGAAAATGGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  61454 GTGTGAACGGACACTGAAATATTTTCTAGGAATTGCGGGAGGAAAATGGG

   5400     .    :    .    :    .    :    .    :    .    :
   5257 TAGTTAGCTATTTCT         GGGTGACCCAGTCTATTAAAGAAAGA
        |||||||||||||||>>>...>>>||||||||||||||||||||||||||
  61504 TAGTTAGCTATTTCTGTA...TAGGGGTGACCCAGTCTATTAAAGAAAGA

   5450     .    :    .    :    .    :    .    :    .    :
   5298 AAAATGCTGAATGAG         CATGATTTTGAAGTCAGAGGAGATGT
        |||||||||||||||>>>...>>>||||||||||||||||||||||||||
  62045 AAAATGCTGAATGAGGTA...CAGCATGATTTTGAAGTCAGAGGAGATGT

   5500     .    :    .    :    .    :    .    :    .    :
   5339 GGTCAATGGAAGAAACCACCAAGGTCCAAAGCGAGCAAGAGAATCCCAGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  68283 GGTCAATGGAAGAAACCACCAAGGTCCAAAGCGAGCAAGAGAATCCCAGG

   5550     .    :    .    :    .    :    .    :    .    :
   5389 ACAGAAAG         ATCTTCAGGGGGCTAGAAATCTGTTGCTATGGG
        ||||||||>>>...>>>|||||||||||||||||||||||||||||||||
  68333 ACAGAAAGGTA...CAGATCTTCAGGGGGCTAGAAATCTGTTGCTATGGG

   5600     .    :    .    :    .    :    .    :    .    :
   5430 CCCTTCACCAACATGCCCACAG         ATCAACTGGAATGGATGGT
        ||||||||||||||||||||||>>>...>>>|||||||||||||||||||
  74308 CCCTTCACCAACATGCCCACAGGTA...TAGATCAACTGGAATGGATGGT

   5650     .    :    .    :    .    :    .    :    .    :
   5471 ACAGCTGTGTGGTGCTTCTGTGGTGAAGGAGCTTTCATCATTCACCCTTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  76217 ACAGCTGTGTGGTGCTTCTGTGGTGAAGGAGCTTTCATCATTCACCCTTG

   5700     .    :    .    :    .    :    .    :    .    :
   5521 GCACA         GGTGTCCACCCAATTGTGGTTGTGCAGCCAGATGCC
        |||||>>>...>>>||||||||||||||||||||||||||||||||||||
  76267 GCACAGTA...CAGGGTGTCCACCCAATTGTGGTTGTGCAGCCAGATGCC

   5750     .    :    .    :    .    :    .    :    .    :
   5562 TGGACAGAGGACAATGGCTTCCATG         CAATTGGGCAGATGTG
        |||||||||||||||||||||||||>>>...>>>||||||||||||||||
  77725 TGGACAGAGGACAATGGCTTCCATGGTA...CAGCAATTGGGCAGATGTG

   5800     .    :    .    :    .    :    .    :    .    :
   5603 TGAGGCACCTGTGGTGACCCGAGAGTGGGTGTTGGACAGTGTAGCACTCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  79606 TGAGGCACCTGTGGTGACCCGAGAGTGGGTGTTGGACAGTGTAGCACTCT

   5850     .    :    .    :    .    :    .    :    .    :
   5653 ACCAGTGCCAGGAGCTGGACACCTACCTGATACCCCAGATCCCCCACAGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  79656 ACCAGTGCCAGGAGCTGGACACCTACCTGATACCCCAGATCCCCCACAGC

   5900     .
   5703 CACTACTGA
        |||||||||
  79706 CACTACTGA

END