Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: U57745.1
Subject Sequence ID: ENSG00000101017
Subject Sequence type: 2


seq1 = /RAID/mart2/Splice/web_temp/fasta/U57745.1, 815 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000101017 (ENSG00000101017), 11025 bp

>gi|1480642|gb|U57745.1|BTU57745 Bos taurus membrane protein CD40 mRNA, partial cds
>ENSG00000101017

133-229  (3963-4059)   83% ==
301-311  (4382-4392)   100% ==
394-409  (4475-4490)   93% ->
410-510  (4860-4960)   84% ==
587-607  (9893-9913)   95%

      0     .    :    .    :    .    :    .    :    .    :
    133 CCGGGACAGAAACTGGTGAACGACTGCACAGAGGTCAGCAAAACAGAATG
        || ||||||||||||||||  |||||||||||| |||   |||| |||||
   3963 CCAGGACAGAAACTGGTGAGTGACTGCACAGAGTTCACTGAAACGGAATG

     50     .    :    .    :    .    :    .    :    .    :
    183 CCAGTCCT GCGGT AAAGGCGAATT CTTGTCCACCTGGAACAGAGAGA
        || -||||-|||||-||||-||||||-|| | |-||||||||||||||||
   4013 CCT TCCTTGCGGTGAAAG CGAATTCCTAGAC ACCTGGAACAGAGAGA

      0     .    :
    301 ACAGACACCAT
        |||||||||||
   4382 ACAGACACCAT

      0     .    :    .    :    .    :    .    :    .    :
    394 GGGGTCAAGCAGATCG         CTACAGGGCTTT TGGATACCGTCT
        |||||||||||||| |>>>...>>>|||||||| |||-||-||||| |||
   4475 GGGGTCAAGCAGATTGGTA...CAGCTACAGGGGTTTCTG ATACCATCT

     50     .    :    .    :    .    :    .    :    .    :
    434 GTGAACCCTGCCC GCTCGGCTTCTTCTCCAACGTGTCATCTGCTTTTGA
        | || ||||||||-|-|||||||||||||||| |||||||||||||| ||
   4884 GCGAGCCCTGCCCAG TCGGCTTCTTCTCCAATGTGTCATCTGCTTTCGA

    100     .    :    .    :    .
    483 AAAGTGTCACCGTTGGACAAGCTGCGAG
        ||| ||||||| ||||||||| |   ||
   4933 AAAATGTCACCCTTGGACAAGGTATAAG

      0     .    :    .    :
    587 CCCTGGTGGTGATCCCCGTCA
        ||||||||||||||||| |||
   9893 CCCTGGTGGTGATCCCCATCA

END