Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: W52051.1
Subject Sequence ID: ENSG00000001626
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/W52051.1, 365 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000001626 (ENSG00000001626), 188699 bp

>gi|1349955|gb|W52051.1|W52051 zc91b04.r1 Pancreatic Islet Homo sapiens cDNA clone IMAGE:338479 5' similar to gb:M28668 CYSTIC FIBROSIS TRANSMEMBRANE CONDUCTANCE REGULATOR (HUMAN);, mRNA sequence
>ENSG00000001626

1-99  (112597-112695)   97% ->
100-228  (114968-115096)   99% ->
229-266  (122864-122901)   100% ->
267-365  (123570-123665)   96%

      0     .    :    .    :    .    :    .    :    .    :
      1 CCTCA GNAAACTTGACTGAACTGGATATATATTCAAGAAGGTTATCTCA
        |||||-| ||||||||||||||||||||||||||||||||||||||||||
 112597 CCTCAGGCAAACTTGACTGAACTGGATATATATTCAAGAAGGTTATCTCA

     50     .    :    .    :    .    :    .    :    .    :
     50 AGAAACTGGCTTGGAAATAAGTGAAGAAATTAACCGAAGAAGACTTAAAG
        ||||||||||||||||||||||||||||||||||-|||||||||||||||
 112647 AGAAACTGGCTTGGAAATAAGTGAAGAAATTAAC GAAGAAGACTTAAAG

    100     .    :    .    :    .    :    .    :    .    :
    100          GAGTGCTTTTTTGATGATATGGAGAGCATACCAGCAGTGAC
        >>>...>>>|||||||||||||||||||||||||||||||||||||||||
 112696 GTA...CAGGAGTGCTTTTTTGATGATATGGAGAGCATACCAGCAGTGAC

    150     .    :    .    :    .    :    .    :    .    :
    141 TACATGGAACACATACCTTCGATATATTACGGTCCACAAGAGCTTAATTT
        |||||||||||||||||||||||||||||| |||||||||||||||||||
 115009 TACATGGAACACATACCTTCGATATATTACTGTCCACAAGAGCTTAATTT

    200     .    :    .    :    .    :    .    :    .    :
    191 TTGTGCTAATTTGGTGCTTAGTAATTTTTCTGGCAGAG         GTG
        ||||||||||||||||||||||||||||||||||||||>>>...>>>|||
 115059 TTGTGCTAATTTGGTGCTTAGTAATTTTTCTGGCAGAGGTA...CAGGTG

    250     .    :    .    :    .    :    .    :    .    :
    232 GCTGCTTCTTTGGTTGTGCTGTGGCTCCTTGGAAA         CACTCC
        |||||||||||||||||||||||||||||||||||>>>...>>>||||||
 122867 GCTGCTTCTTTGGTTGTGCTGTGGCTCCTTGGAAAGTG...CAGCACTCC

    300     .    :    .    :    .    :    .    :    .    :
    273 TCTTCAAGACAAAGGGAATANGTACTCATAGTTAGAAATAACAGCTATGC
        ||||||||||||||||||||-||||||||||-||||||||||||||||||
 123576 TCTTCAAGACAAAGGGAATA GTACTCATAG TAGAAATAACAGCTATGC

    350     .    :    .    :    .    :    .    :
    323 AGTTGATTATCACCAGCACCAGTTCGTATTATGTGTTTTACAT
        |||-|||||||||||||||||||||||||||||||||||||||
 123624 AGT GATTATCACCAGCACCAGTTCGTATTATGTGTTTTACAT

END