Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: X00173.1
Subject Sequence ID: ENSG00000017427
Subject Sequence type: 2


seq1 = /RAID/mart2/Splice/web_temp/fasta/X00173.1, 725 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000017427 (ENSG00000017427), 78292 bp

>gi|33015|emb|X00173.1|HSIGFI Homo sapiens mRNA for insulin-like growth factor 1A precursor, complete CDS
>ENSG00000017427

(complement)

1-74  (155-228)   100% ->
75-231  (4748-4904)   100% ->
232-413  (60857-61038)   99% ->
414-725  (77981-78292)   100%

      0     .    :    .    :    .    :    .    :    .    :
      1 CTTCAGAAGCAATGGGAAAAATCAGCAGTCTTCCAACCCAATTATTTAAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    155 CTTCAGAAGCAATGGGAAAAATCAGCAGTCTTCCAACCCAATTATTTAAG

     50     .    :    .    :    .    :    .    :    .    :
     51 TGCTGCTTTTGTGATTTCTTGAAG         GTGAAGATGCACACCAT
        ||||||||||||||||||||||||>>>...>>>|||||||||||||||||
    205 TGCTGCTTTTGTGATTTCTTGAAGGTA...CAGGTGAAGATGCACACCAT

    100     .    :    .    :    .    :    .    :    .    :
     92 GTCCTCCTCGCATCTCTTCTACCTGGCGCTGTGCCTGCTCACCTTCACCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   4765 GTCCTCCTCGCATCTCTTCTACCTGGCGCTGTGCCTGCTCACCTTCACCA

    150     .    :    .    :    .    :    .    :    .    :
    142 GCTCTGCCACGGCTGGACCGGAGACGCTCTGCGGGGCTGAGCTGGTGGAT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   4815 GCTCTGCCACGGCTGGACCGGAGACGCTCTGCGGGGCTGAGCTGGTGGAT

    200     .    :    .    :    .    :    .    :    .    :
    192 GCTCTTCAGTTCGTGTGTGGAGACAGGGGCTTTTATTTCA         A
        ||||||||||||||||||||||||||||||||||||||||>>>...>>>|
   4865 GCTCTTCAGTTCGTGTGTGGAGACAGGGGCTTTTATTTCAGTA...CAGA

    250     .    :    .    :    .    :    .    :    .    :
    233 CAAGCCCACAGGGTATGGCTCCAGCAGTCGGAGGGCGCCTCAGACAGGTA
        |||||||||||||||||||||||||||||||||||||||||||||||| |
  60858 CAAGCCCACAGGGTATGGCTCCAGCAGTCGGAGGGCGCCTCAGACAGGCA

    300     .    :    .    :    .    :    .    :    .    :
    283 TCGTGGATGAGTGCTGCTTCCGGAGCTGTGATCTAAGGAGGCTGGAGATG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  60908 TCGTGGATGAGTGCTGCTTCCGGAGCTGTGATCTAAGGAGGCTGGAGATG

    350     .    :    .    :    .    :    .    :    .    :
    333 TATTGCGCACCCCTCAAGCCTGCCAAGTCAGCTCGCTCTGTCCGTGCCCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  60958 TATTGCGCACCCCTCAAGCCTGCCAAGTCAGCTCGCTCTGTCCGTGCCCA

    400     .    :    .    :    .    :    .    :    .    :
    383 GCGCCACACCGACATGCCCAAGACCCAGAAG         GAAGTACATT
        |||||||||||||||||||||||||||||||>>>...>>>||||||||||
  61008 GCGCCACACCGACATGCCCAAGACCCAGAAGGTA...TAGGAAGTACATT

    450     .    :    .    :    .    :    .    :    .    :
    424 TGAAGAACGCAAGTAGAGGGAGTGCAGGAAACAAGAACTACAGGATGTAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  77991 TGAAGAACGCAAGTAGAGGGAGTGCAGGAAACAAGAACTACAGGATGTAG

    500     .    :    .    :    .    :    .    :    .    :
    474 GAAGACCCTCCTGAGGAGTGAAGAGTGACATGCCACCGCAGGATCCTTTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  78041 GAAGACCCTCCTGAGGAGTGAAGAGTGACATGCCACCGCAGGATCCTTTG

    550     .    :    .    :    .    :    .    :    .    :
    524 CTCTGCACGAGTTACCTGTTAAACTTTGGAACACCTACCAAAAAATAAGT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  78091 CTCTGCACGAGTTACCTGTTAAACTTTGGAACACCTACCAAAAAATAAGT

    600     .    :    .    :    .    :    .    :    .    :
    574 TTGATAACATTTAAAAGATGGGCGTTTCCCCCAATGAAATACACAAGTAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  78141 TTGATAACATTTAAAAGATGGGCGTTTCCCCCAATGAAATACACAAGTAA

    650     .    :    .    :    .    :    .    :    .    :
    624 ACATTCCAACATTGTCTTTAGGAGTGATTTGCACCTTGCAAAAATGGTCC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  78191 ACATTCCAACATTGTCTTTAGGAGTGATTTGCACCTTGCAAAAATGGTCC

    700     .    :    .    :    .    :    .    :    .    :
    674 TGGAGTTGGTAGATTGCTGTTGATCTTTTATCAATAATGTTCTATAGAAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  78241 TGGAGTTGGTAGATTGCTGTTGATCTTTTATCAATAATGTTCTATAGAAA

    750 
    724 AG
        ||
  78291 AG

END