Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: X60592.1
Subject Sequence ID: ENSG00000101017
Subject Sequence type: 2


seq1 = /RAID/mart2/Splice/web_temp/fasta/X60592.1, 1004 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000101017 (ENSG00000101017), 11025 bp

>gi|29850|emb|X60592.1|HSCDW40 Human CDw40 mRNA for nerve growth factor receptor-related B-lymphocyte activation molecule
>ENSG00000101017

1-98  (31-128)   98% ->
99-177  (3554-3632)   100% ->
178-303  (3967-4092)   100% ->
304-450  (4344-4490)   100% ->
451-544  (4860-4953)   100% ->
545-606  (8374-8435)   100% ->
607-693  (9872-9958)   100% ->
694-722  (10064-10092)   100% ->
723-965  (10616-10859)   98%

      0     .    :    .    :    .    :    .    :    .    :
      1 GCCTCGCTCGGGCGCCCAGTGGTCCTGCCGCCTGGTCTCACCTCGCCATG
        |||||||||||||||||||||||||||||||||||||||||||||| |||
     31 GCCTCGCTCGGGCGCCCAGTGGTCCTGCCGCCTGGTCTCACCTCGCTATG

     50     .    :    .    :    .    :    .    :    .    :
     51 GTTCGTCTGCCTCTGCAGTGCGTCCTCTGGGGCTGCTTGCTGACCGCT  
        ||||||||||||||||||||||||||||||||||||||||||||||||>>
     81 GTTCGTCTGCCTCTGCAGTGCGTCCTCTGGGGCTGCTTGCTGACCGCTGT

    100     .    :    .    :    .    :    .    :    .    :
     99        GTCCATCCAGAACCACCCACTGCATGCAGAGAAAAACAGTACC
        >...>>>|||||||||||||||||||||||||||||||||||||||||||
    131 G...TAGGTCCATCCAGAACCACCCACTGCATGCAGAGAAAAACAGTACC

    150     .    :    .    :    .    :    .    :    .    :
    142 TAATAAACAGTCAGTGCTGTTCTTTGTGCCAGCCAG         GACAG
        ||||||||||||||||||||||||||||||||||||>>>...>>>|||||
   3597 TAATAAACAGTCAGTGCTGTTCTTTGTGCCAGCCAGGTG...CAGGACAG

    200     .    :    .    :    .    :    .    :    .    :
    183 AAACTGGTGAGTGACTGCACAGAGTTCACTGAAACGGAATGCCTTCCTTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   3972 AAACTGGTGAGTGACTGCACAGAGTTCACTGAAACGGAATGCCTTCCTTG

    250     .    :    .    :    .    :    .    :    .    :
    233 CGGTGAAAGCGAATTCCTAGACACCTGGAACAGAGAGACACACTGCCACC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   4022 CGGTGAAAGCGAATTCCTAGACACCTGGAACAGAGAGACACACTGCCACC

    300     .    :    .    :    .    :    .    :    .    :
    283 AGCACAAATACTGCGACCCCA         ACCTAGGGCTTCGGGTCCAG
        |||||||||||||||||||||>>>...>>>||||||||||||||||||||
   4072 AGCACAAATACTGCGACCCCAGTG...CAGACCTAGGGCTTCGGGTCCAG

    350     .    :    .    :    .    :    .    :    .    :
    324 CAGAAGGGCACCTCAGAAACAGACACCATCTGCACCTGTGAAGAAGGCTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   4364 CAGAAGGGCACCTCAGAAACAGACACCATCTGCACCTGTGAAGAAGGCTG

    400     .    :    .    :    .    :    .    :    .    :
    374 GCACTGTACGAGTGAGGCCTGTGAGAGCTGTGTCCTGCACCGCTCATGCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   4414 GCACTGTACGAGTGAGGCCTGTGAGAGCTGTGTCCTGCACCGCTCATGCT

    450     .    :    .    :    .    :    .    :    .    :
    424 CGCCCGGCTTTGGGGTCAAGCAGATTG         CTACAGGGGTTTCT
        |||||||||||||||||||||||||||>>>...>>>||||||||||||||
   4464 CGCCCGGCTTTGGGGTCAAGCAGATTGGTA...CAGCTACAGGGGTTTCT

    500     .    :    .    :    .    :    .    :    .    :
    465 GATACCATCTGCGAGCCCTGCCCAGTCGGCTTCTTCTCCAATGTGTCATC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   4874 GATACCATCTGCGAGCCCTGCCCAGTCGGCTTCTTCTCCAATGTGTCATC

    550     .    :    .    :    .    :    .    :    .    :
    515 TGCTTTCGAAAAATGTCACCCTTGGACAAG         CTGTGAGACCA
        ||||||||||||||||||||||||||||||>>>...>>>|||||||||||
   4924 TGCTTTCGAAAAATGTCACCCTTGGACAAGGTA...TAGCTGTGAGACCA

    600     .    :    .    :    .    :    .    :    .    :
    556 AAGACCTGGTTGTGCAACAGGCAGGCACAAACAAGACTGATGTTGTCTGT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   8385 AAGACCTGGTTGTGCAACAGGCAGGCACAAACAAGACTGATGTTGTCTGT

    650     .    :    .    :    .    :    .    :    .    :
    606 G         GTCCCCAGGATCGGCTGAGAGCCCTGGTGGTGATCCCCAT
        |>>>...>>>||||||||||||||||||||||||||||||||||||||||
   8435 GGTG...CAGGTCCCCAGGATCGGCTGAGAGCCCTGGTGGTGATCCCCAT

    700     .    :    .    :    .    :    .    :    .    :
    647 CATCTTCGGGATCCTGTTTGCCATCCTCTTGGTGCTGGTCTTTATCA   
        |||||||||||||||||||||||||||||||||||||||||||||||>>>
   9912 CATCTTCGGGATCCTGTTTGCCATCCTCTTGGTGCTGGTCTTTATCAGTG

    750     .    :    .    :    .    :    .    :    .    :
    694       AAAAGGTGGCCAAGAAGCCAACCAATAAG         GCCCCC
        ...>>>|||||||||||||||||||||||||||||>>>...>>>||||||
   9962 ...TAGAAAAGGTGGCCAAGAAGCCAACCAATAAGGTA...CAGGCCCCC

    800     .    :    .    :    .    :    .    :    .    :
    729 CACCCCAAGCAGGAACCCCAGGAGATCAATTTTCCCGACGATCTTCCTGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  10622 CACCCCAAGCAGGAACCCCAGGAGATCAATTTTCCCGACGATCTTCCTGG

    850     .    :    .    :    .    :    .    :    .    :
    779 CTCCAACACTGCTGCTCCAGTGCAGGAGACTTTACATGGATGCCAACCGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  10672 CTCCAACACTGCTGCTCCAGTGCAGGAGACTTTACATGGATGCCAACCGG

    900     .    :    .    :    .    :    .    :    .    :
    829 TCACCCAGGAGGATGGCAAAGAGAGTCGCATCTCAGTGCAGGAGAGACAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  10722 TCACCCAGGAGGATGGCAAAGAGAGTCGCATCTCAGTGCAGGAGAGACAG

    950     .    :    .    :    .    :    .    :    .    :
    879 TGAGGCTGCACCCACCCAGGAGTGTGGCCACGTGGGCAAACAGGCAGTTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  10772 TGAGGCTGCACCCACCCAGGAGTGTGGCCACGTGGGCAAACAGGCAGTTG

   1000     .    :    .    :    .    :    .
    929 GCCAGAGAGCCTGGTGCTGCTGCTGCAG GG GTGCAGG
        |||||||||||||||||||||||||| |-||-|||-|||
  10822 GCCAGAGAGCCTGGTGCTGCTGCTGCTGTGGCGTG AGG

END