An integrated system to identify conserved sequence elements
      associated to mRNA splicing



[   MEME   ][   User-Input FASTA   ][   Motif #1   ]

Motif Logos

Motif Energy Dot Plot (0 + 50 + 0)

Motif Secondary Structure ( 0 + 50 + 0)

Motif Statistics  
Gene ID Chromosome Strand  
Use HMM Models to Scan This Gene Set M-->Motif s-->selected region  

Motif Information
Detail ID Gene ID Chromosome Start Position End Position Strand View ProSplicer Splice View
1     51 100 0
2     171 220 0
3     104 153 0
4     28 77 0
5     5 54 0

Motif Simplified PSSM
A 0 2 0 0 2 4 0 2 0 0 6 4 6 0 2 0 2 0 2 2 0 0 0 2 0 0 0 4 2 0 0 2 0 6 2 0 0 0 0 0 0 0 0 0 2 0 2 0 0 0
C 2 6 6 0 6 6 6 2 8 6 0 0 2 4 8 8 2 6 8 2 6 6 8 4 4 8 a 6 2 4 a 0 8 0 2 6 4 a a 8 2 2 0 a 8 a 4 8 8 8
G 8 2 4 8 2 0 2 0 2 2 4 6 2 4 0 2 2 2 0 0 4 4 2 2 6 0 0 0 2 6 0 4 2 4 6 4 6 0 0 2 2 6 8 0 0 0 4 2 2 0
T 0 0 0 2 0 0 2 6 0 2 0 0 0 2 0 0 4 2 0 6 0 0 0 2 0 2 0 0 4 0 0 4 0 0 0 0 0 0 0 0 6 2 2 0 0 0 0 0 0 2

Motif PSSM
Position A C G T
1 0.000505 0.200094 0.798897 0.000505
2 0.200105 0.599296 0.200094 0.000505
3 0.000505 0.599296 0.399695 0.000505
4 0.000505 0.000493 0.798897 0.200105
5 0.200105 0.599296 0.200094 0.000505
6 0.399706 0.599296 0.000493 0.000505
7 0.000505 0.599296 0.200094 0.200105
8 0.200105 0.200094 0.000493 0.599307
9 0.000505 0.798897 0.200094 0.000505
10 0.000505 0.599296 0.200094 0.200105
11 0.599307 0.000493 0.399695 0.000505
12 0.399706 0.000493 0.599296 0.000505
13 0.599307 0.200094 0.200094 0.000505
14 0.000505 0.399695 0.399695 0.200105
15 0.200105 0.798897 0.000493 0.000505
16 0.000505 0.798897 0.200094 0.000505
17 0.200105 0.200094 0.200094 0.399706
18 0.000505 0.599296 0.200094 0.200105
19 0.200105 0.798897 0.000493 0.000505
20 0.200105 0.200094 0.000493 0.599307
21 0.000505 0.599296 0.399695 0.000505
22 0.000505 0.599296 0.399695 0.000505
23 0.000505 0.798897 0.200094 0.000505
24 0.200105 0.399695 0.200094 0.200105
25 0.000505 0.399695 0.599296 0.000505
26 0.000505 0.798897 0.000493 0.200105
27 0.000505 0.998497 0.000493 0.000505
28 0.399706 0.599296 0.000493 0.000505
29 0.200105 0.200094 0.200094 0.399706
30 0.000505 0.399695 0.599296 0.000505
31 0.000505 0.998497 0.000493 0.000505
32 0.200105 0.000493 0.399695 0.399706
33 0.000505 0.798897 0.200094 0.000505
34 0.599307 0.000493 0.399695 0.000505
35 0.200105 0.200094 0.599296 0.000505
36 0.000505 0.599296 0.399695 0.000505
37 0.000505 0.399695 0.599296 0.000505
38 0.000505 0.998497 0.000493 0.000505
39 0.000505 0.998497 0.000493 0.000505
40 0.000505 0.798897 0.200094 0.000505
41 0.000505 0.200094 0.200094 0.599307
42 0.000505 0.200094 0.599296 0.200105
43 0.000505 0.000493 0.798897 0.200105
44 0.000505 0.998497 0.000493 0.000505
45 0.200105 0.798897 0.000493 0.000505
46 0.000505 0.998497 0.000493 0.000505
47 0.200105 0.399695 0.399695 0.000505
48 0.000505 0.798897 0.200094 0.000505
49 0.000505 0.798897 0.200094 0.000505
50 0.000505 0.798897 0.000493 0.200105

Motif FASTA
1 cgggcagagc GGGGCACCCCAAAGCCTCCAGGGCCCCCTGCTCAGCCCCCTGGCCCGCCC aacgcctcta
2 catcaggagg GACGGCGTCCAGATCCGCCTCCCACCCAGGCGCGGCGCCCTGGCCCACCC ggggcggccg
3 cccctacacg GCCGCCCTCCAGGCCCCCCTCGCGGCCATCCAGACCCCCGTCTCACCCCT ctgctcatgg
4 ccagcctacc GCCTCCTTCTGGCCACTTACGCCCGTCCCCCTCGAGGCCCGGGCCCCCCC acacccgcct
5 cccggccagc CCGGAACAGGGAAGCGAGCTCCCTGCCCAGCGCAGGGCCCCTGCCCGGGC cttc


Department of Computer Science and Information Engineering
National Central University
No.300, Jung-Da Rd., Chung-li , Tao-yuan, Taiwan, 320, R.O.C.
Department of Biological Science and Technology, Institute of Bioinformatics
National Chiao Tung University
1001 Ta Hsueh Road, Hsinchu, Taiwan 300, ROC
Contact with bryan@mail.NCTU.edu.tw







Array
(
    [login] => 64
    [mysid] => n603fg6t3403g5f9su9e56the6
    [email] => hcc@db.csie.ncu.edu.tw
)