An integrated system to identify conserved sequence elements
      associated to mRNA splicing



[   MEME   ][   User-Input FASTA   ][   Motif #2   ]

Motif Logos

Motif Energy Dot Plot (0 + 50 + 0)

Motif Secondary Structure ( 0 + 50 + 0)

Motif Statistics  
Gene ID Chromosome Strand  
Use HMM Models to Scan This Gene Set M-->Motif s-->selected region  

Motif Information
Detail ID Gene ID Chromosome Start Position End Position Strand View ProSplicer Splice View
1     44 93 0
2     44 93 0
3     2 51 0
4     39 88 0

Motif Simplified PSSM
A 0 a 0 0 6 2 0 2 0 0 2 a 0 4 0 6 0 0 0 6 a 6 4 2 0 2 6 0 0 0 6 0 4 0 0 6 8 0 4 0 2 2 0 0 6 2 2 0 2 0
C 8 0 0 2 4 6 6 0 0 0 8 0 0 0 6 2 4 2 2 0 0 0 0 4 2 0 4 4 2 8 0 2 0 a a 2 2 0 0 0 4 4 a a 4 0 0 2 4 0
G 2 0 2 6 0 2 0 6 4 a 0 0 a 4 4 0 6 2 8 4 0 0 4 4 6 8 0 0 0 2 0 2 6 0 0 0 0 a 4 8 2 2 0 0 0 2 8 0 0 8
T 0 0 8 2 0 0 4 2 6 0 0 0 0 2 0 2 0 6 0 0 0 4 2 0 2 0 0 6 8 0 4 6 0 0 0 2 0 0 2 2 2 2 0 0 0 6 0 8 4 2

Motif PSSM
Position A C G T
1 0.000505 0.798897 0.200094 0.000505
2 0.998509 0.000493 0.000493 0.000505
3 0.000505 0.000493 0.200094 0.798908
4 0.000505 0.200094 0.599296 0.200105
5 0.599307 0.399695 0.000493 0.000505
6 0.200105 0.599296 0.200094 0.000505
7 0.000505 0.599296 0.000493 0.399706
8 0.200105 0.000493 0.599296 0.200105
9 0.000505 0.000493 0.399695 0.599307
10 0.000505 0.000493 0.998497 0.000505
11 0.200105 0.798897 0.000493 0.000505
12 0.998509 0.000493 0.000493 0.000505
13 0.000505 0.000493 0.998497 0.000505
14 0.399706 0.000493 0.399695 0.200105
15 0.000505 0.599296 0.399695 0.000505
16 0.599307 0.200094 0.000493 0.200105
17 0.000505 0.399695 0.599296 0.000505
18 0.000505 0.200094 0.200094 0.599307
19 0.000505 0.200094 0.798897 0.000505
20 0.599307 0.000493 0.399695 0.000505
21 0.998509 0.000493 0.000493 0.000505
22 0.599307 0.000493 0.000493 0.399706
23 0.399706 0.000493 0.399695 0.200105
24 0.200105 0.399695 0.399695 0.000505
25 0.000505 0.200094 0.599296 0.200105
26 0.200105 0.000493 0.798897 0.000505
27 0.599307 0.399695 0.000493 0.000505
28 0.000505 0.399695 0.000493 0.599307
29 0.000505 0.200094 0.000493 0.798908
30 0.000505 0.798897 0.200094 0.000505
31 0.599307 0.000493 0.000493 0.399706
32 0.000505 0.200094 0.200094 0.599307
33 0.399706 0.000493 0.599296 0.000505
34 0.000505 0.998497 0.000493 0.000505
35 0.000505 0.998497 0.000493 0.000505
36 0.599307 0.200094 0.000493 0.200105
37 0.798908 0.200094 0.000493 0.000505
38 0.000505 0.000493 0.998497 0.000505
39 0.399706 0.000493 0.399695 0.200105
40 0.000505 0.000493 0.798897 0.200105
41 0.200105 0.399695 0.200094 0.200105
42 0.200105 0.399695 0.200094 0.200105
43 0.000505 0.998497 0.000493 0.000505
44 0.000505 0.998497 0.000493 0.000505
45 0.599307 0.399695 0.000493 0.000505
46 0.200105 0.000493 0.200094 0.599307
47 0.200105 0.000493 0.798897 0.000505
48 0.000505 0.200094 0.000493 0.798908
49 0.200105 0.399695 0.000493 0.399706
50 0.000505 0.000493 0.798897 0.200105

Motif FASTA
1 gagatttgtt CATGAGCGTGCAGTCACTCAATGGGGATTCTTACCAAGGGGCCCAGGTTG gagccaacgt
2 gggacatgtt CATGAACATGCAGAGTCTGAATGGGGATTCTTACCAAGGGTCCCAAGTCG gagccaatgt
3 a CATCACTGGGCAGGGAGGGGAATCTACTTGATGCCAAGAGAACCATGTTT cttaaagcca
4 ttggcacgca GAGGCCCTGGCAGGCCGCGGAAACGGACCCACGCCCCGAGCGCCCTGTCG cccccccgca


Department of Computer Science and Information Engineering
National Central University
No.300, Jung-Da Rd., Chung-li , Tao-yuan, Taiwan, 320, R.O.C.
Department of Biological Science and Technology, Institute of Bioinformatics
National Chiao Tung University
1001 Ta Hsueh Road, Hsinchu, Taiwan 300, ROC
Contact with bryan@mail.NCTU.edu.tw







Array
(
    [login] => 68
    [mysid] => n603fg6t3403g5f9su9e56the6
    [email] => hcc@db.csie.ncu.edu.tw
)