An integrated system to identify conserved sequence elements
      associated to mRNA splicing



[   MEME   ][   User-Input FASTA   ][   Motif #3   ]

Motif Logos

Motif Energy Dot Plot (0 + 26 + 0)

Motif Secondary Structure ( 0 + 26 + 0)

Motif Statistics  
Gene ID Chromosome Strand  
Use HMM Models to Scan This Gene Set M-->Motif s-->selected region  

Motif Information
Detail ID Gene ID Chromosome Start Position End Position Strand View ProSplicer Splice View
1     14 39 0

Motif Simplified PSSM
A 0 0 0 0 a 0 0 0 0 0 0 0 0 0 0 0 a 0 0 5 0 0 0 0 a 0
C 0 a 0 0 0 a 5 a 5 0 a 0 a a 5 0 0 0 a 0 a a a a 0 0
G a 0 a a 0 0 0 0 0 5 0 0 0 0 5 a 0 a 0 5 0 0 0 0 0 a
T 0 0 0 0 0 0 5 0 5 5 0 a 0 0 0 0 0 0 0 0 0 0 0 0 0 0

Motif PSSM
Position A C G T
1 0.001258 0.00123 0.996255 0.001258
2 0.001258 0.996255 0.00123 0.001258
3 0.001258 0.00123 0.996255 0.001258
4 0.001258 0.00123 0.996255 0.001258
5 0.996283 0.00123 0.00123 0.001258
6 0.001258 0.996255 0.00123 0.001258
7 0.001258 0.498742 0.00123 0.49877
8 0.001258 0.996255 0.00123 0.001258
9 0.001258 0.498742 0.00123 0.49877
10 0.001258 0.00123 0.498742 0.49877
11 0.001258 0.996255 0.00123 0.001258
12 0.001258 0.00123 0.00123 0.996283
13 0.001258 0.996255 0.00123 0.001258
14 0.001258 0.996255 0.00123 0.001258
15 0.001258 0.498742 0.498742 0.001258
16 0.001258 0.00123 0.996255 0.001258
17 0.996283 0.00123 0.00123 0.001258
18 0.001258 0.00123 0.996255 0.001258
19 0.001258 0.996255 0.00123 0.001258
20 0.49877 0.00123 0.498742 0.001258
21 0.001258 0.996255 0.00123 0.001258
22 0.001258 0.996255 0.00123 0.001258
23 0.001258 0.996255 0.00123 0.001258
24 0.001258 0.996255 0.00123 0.001258
25 0.996283 0.00123 0.00123 0.001258
26 0.001258 0.00123 0.996255 0.001258

Motif FASTA
1 tccgtgtaga GCGGACCCCTCTCCCGAGCGCCCCAG tcctccccga


Department of Computer Science and Information Engineering
National Central University
No.300, Jung-Da Rd., Chung-li , Tao-yuan, Taiwan, 320, R.O.C.
Department of Biological Science and Technology, Institute of Bioinformatics
National Chiao Tung University
1001 Ta Hsueh Road, Hsinchu, Taiwan 300, ROC
Contact with bryan@mail.NCTU.edu.tw







Array
(
    [login] => 63
    [mysid] => n603fg6t3403g5f9su9e56the6
    [email] => hcc@db.csie.ncu.edu.tw
)