An integrated system to identify conserved sequence elements
      associated to mRNA splicing



[   MEME   ][   3'-flanking Region (Intronic)   ][   Motif #1   ]

Motif Logos

Motif Secondary Structure ( 25 + 50 + 25)

Motif Statistics  
Gene ID Chromosome Strand Exon
1
Intron
1
Exon
2
Intron
2
Exon
3
Intron
3
Exon
4
Intron
4
Exon
5
Intron
5
Exon
6
Intron
6
Exon
7
Intron
7
Exon
8
Intron
8
Exon
9
Intron
9
Exon
10
Intron
10
Exon
11
Intron
11
Exon
12
Intron
12
Exon
13
Intron
13
Exon
14
Intron
14
Exon
15
Intron
15
Exon
16
Intron
16
Exon
17
Intron
17
Exon
18
Intron
18
Exon
19
Intron
19
Exon
20
Intron
20
Exon
21
Intron
21
Exon
22
Intron
22
Exon
23
Intron
23
Exon
24
Intron
24
Exon
25
Intron
25
Exon
26
 
ENSG00000012048 HMM 17 -1                                                                                                                                                          0/0
Use HMM Models to Scan This Gene Set M-->Motif s-->selected region  

Motif Information
Detail ID Gene ID Chromosome Start Position End Position Strand View ProSplicer Splice View
1 ENSG00000012048  17  41622478 41622527 -1
2 ENSG00000012048  17  41625086 41625135 -1
3 ENSG00000012048  17  41650675 41650724 -1
4 ENSG00000012048  17  41650687 41650736 -1
5 ENSG00000012048  17  41621120 41621169 -1

Motif Simplified PSSM
A 6 6 4 0 0 0 0 0 4 0 4 0 6 0 0 2 0 0 0 0 0 0 0 0 6 0 0 4 0 4 0 4 4 0 0 0 6 6 0 0 0 2 0 2 4 0 0 0 0 a
C 0 0 6 2 0 0 0 0 0 8 0 6 0 a 2 2 0 0 0 0 0 2 4 4 4 0 4 6 0 0 0 0 6 4 0 0 0 0 a 4 a 8 0 0 4 6 a 0 a 0
G 4 4 0 6 8 a a a 0 0 0 4 4 0 0 4 0 a 4 4 a 4 0 0 0 4 6 0 4 6 6 0 0 0 0 a 4 4 0 0 0 0 0 8 2 4 0 0 0 0
T 0 0 0 2 2 0 0 0 6 2 6 0 0 0 8 2 a 0 6 6 0 4 6 6 0 6 0 0 6 0 4 6 0 6 a 0 0 0 0 6 0 0 a 0 0 0 0 a 0 0

Motif PSSM
Position A C G T
1 0.599374 0.000426 0.399628 0.000572
2 0.599374 0.000426 0.399628 0.000572
3 0.399773 0.599229 0.000426 0.000572
4 0.000572 0.200027 0.599229 0.200172
5 0.000572 0.000426 0.79883 0.200172
6 0.000572 0.000426 0.99843 0.000572
7 0.000572 0.000426 0.99843 0.000572
8 0.000572 0.000426 0.99843 0.000572
9 0.399773 0.000426 0.000426 0.599374
10 0.000572 0.79883 0.000426 0.200172
11 0.399773 0.000426 0.000426 0.599374
12 0.000572 0.599229 0.399628 0.000572
13 0.599374 0.000426 0.399628 0.000572
14 0.000572 0.99843 0.000426 0.000572
15 0.000572 0.200027 0.000426 0.798975
16 0.200172 0.200027 0.399628 0.200172
17 0.000572 0.000426 0.000426 0.998576
18 0.000572 0.000426 0.99843 0.000572
19 0.000572 0.000426 0.399628 0.599374
20 0.000572 0.000426 0.399628 0.599374
21 0.000572 0.000426 0.99843 0.000572
22 0.000572 0.200027 0.399628 0.399773
23 0.000572 0.399628 0.000426 0.599374
24 0.000572 0.399628 0.000426 0.599374
25 0.599374 0.399628 0.000426 0.000572
26 0.000572 0.000426 0.399628 0.599374
27 0.000572 0.399628 0.599229 0.000572
28 0.399773 0.599229 0.000426 0.000572
29 0.000572 0.000426 0.399628 0.599374
30 0.399773 0.000426 0.599229 0.000572
31 0.000572 0.000426 0.599229 0.399773
32 0.399773 0.000426 0.000426 0.599374
33 0.399773 0.599229 0.000426 0.000572
34 0.000572 0.399628 0.000426 0.599374
35 0.000572 0.000426 0.000426 0.998576
36 0.000572 0.000426 0.99843 0.000572
37 0.599374 0.000426 0.399628 0.000572
38 0.599374 0.000426 0.399628 0.000572
39 0.000572 0.99843 0.000426 0.000572
40 0.000572 0.399628 0.000426 0.599374
41 0.000572 0.99843 0.000426 0.000572
42 0.200172 0.79883 0.000426 0.000572
43 0.000572 0.000426 0.000426 0.998576
44 0.200172 0.000426 0.79883 0.000572
45 0.399773 0.399628 0.200027 0.000572
46 0.000572 0.599229 0.399628 0.000572
47 0.000572 0.99843 0.000426 0.000572
48 0.000572 0.000426 0.000426 0.998576
49 0.000572 0.99843 0.000426 0.000572
50 0.998576 0.000426 0.000426 0.000572

Motif FASTA
1 gtaga AACGGGGGTCTCACTTTGTTGGCCAGGCTGGTCTTGAACTCCTAACCTCA aataatccac
2 tattttgtag AGACTGGGTCTCACTCTGTTGCTTATGCTGGTCTTGAACTCCTGGCCTCA agcagtcctg
3 agacttcctg GACGGGGGACAGGCTGTGGGGTTTCTCAGATAACTGGGCCCCTGCGCTCA ggaggccttc
4 agacttcctg GACGGGGGACAGGCTGTGGGGTTTCTCAGATAACTGGGCCCCTGCGCTCA ggaggccttc
5 tttttagtag AGATGGGGTTTCACCATGTTGGCCAGGCTGGTCTTGAACTCATGACCTCA agtggtccac


Department of Computer Science and Information Engineering
National Central University
No.300, Jung-Da Rd., Chung-li , Tao-yuan, Taiwan, 320, R.O.C.
Department of Biological Science and Technology, Institute of Bioinformatics
National Chiao Tung University
1001 Ta Hsueh Road, Hsinchu, Taiwan 300, ROC
Contact with bryan@mail.NCTU.edu.tw







Array
(
    [login] => 97
    [mysid] => n603fg6t3403g5f9su9e56the6
    [email] => hcc@db.csie.ncu.edu.tw
)