An integrated system to identify conserved sequence elements
      associated to mRNA splicing



[   MEME   ][   3'-flanking Region (Intronic)   ][   Motif #2   ]

Motif Logos

Motif Secondary Structure ( 25 + 50 + 25)

Motif Statistics  
Gene ID Chromosome Strand Exon
1
Intron
1
Exon
2
Intron
2
Exon
3
Intron
3
Exon
4
Intron
4
Exon
5
Intron
5
Exon
6
Intron
6
Exon
7
Intron
7
Exon
8
Intron
8
Exon
9
Intron
9
Exon
10
Intron
10
Exon
11
Intron
11
Exon
12
Intron
12
Exon
13
Intron
13
Exon
14
Intron
14
Exon
15
Intron
15
Exon
16
Intron
16
Exon
17
Intron
17
Exon
18
Intron
18
Exon
19
Intron
19
Exon
20
Intron
20
Exon
21
Intron
21
Exon
22
Intron
22
Exon
23
Intron
23
Exon
24
Intron
24
Exon
25
Intron
25
Exon
26
 
ENSG00000012048 HMM 17 -1                                                                                                                                                          0/0
Use HMM Models to Scan This Gene Set M-->Motif s-->selected region  

Motif Information
Detail ID Gene ID Chromosome Start Position End Position Strand View ProSplicer Splice View
1 ENSG00000012048  17  41621184 41621233 -1
2 ENSG00000012048  17  41622542 41622591 -1
3 ENSG00000012048  17  41625147 41625196 -1
4 ENSG00000012048  17  41650617 41650666 -1
5 ENSG00000012048  17  41650629 41650678 -1
6 ENSG00000012048  17  41630293 41630342 -1

Motif Simplified PSSM
A 0 2 0 8 0 2 0 3 0 0 2 5 8 5 2 0 0 0 2 0 0 5 7 0 0 7 0 a 0 2 0 2 2 3 8 0 0 0 a 0 0 0 0 0 3 3 0 3 0 2
C 7 2 a 0 0 8 5 0 5 a 3 5 0 3 0 3 3 5 3 0 3 0 0 0 3 0 7 0 0 0 3 0 0 0 0 0 7 3 0 7 7 0 2 0 5 7 3 0 5 8
G 0 0 0 2 a 0 3 2 3 0 0 0 0 2 8 0 7 3 0 8 5 5 3 0 0 3 0 0 a 5 2 3 0 5 0 5 0 0 0 0 0 7 3 3 2 0 0 3 5 0
T 3 7 0 0 0 0 2 5 2 0 5 0 2 0 0 7 0 2 5 2 2 0 0 a 7 0 3 0 0 3 5 5 8 2 2 5 3 7 0 3 3 3 5 7 0 0 7 3 0 0

Motif PSSM
Position A C G T
1 0.000476 0.665913 0.000355 0.333255
2 0.166866 0.166745 0.000355 0.666034
3 0.000476 0.998692 0.000355 0.000476
4 0.832423 0.000355 0.166745 0.000476
5 0.000476 0.000355 0.998692 0.000476
6 0.166866 0.832302 0.000355 0.000476
7 0.000476 0.499524 0.333134 0.166866
8 0.333255 0.000355 0.166745 0.499645
9 0.000476 0.499524 0.333134 0.166866
10 0.000476 0.998692 0.000355 0.000476
11 0.166866 0.333134 0.000355 0.499645
12 0.499645 0.499524 0.000355 0.000476
13 0.832423 0.000355 0.000355 0.166866
14 0.499645 0.333134 0.166745 0.000476
15 0.166866 0.000355 0.832302 0.000476
16 0.000476 0.333134 0.000355 0.666034
17 0.000476 0.333134 0.665913 0.000476
18 0.000476 0.499524 0.333134 0.166866
19 0.166866 0.333134 0.000355 0.499645
20 0.000476 0.000355 0.832302 0.166866
21 0.000476 0.333134 0.499524 0.166866
22 0.499645 0.000355 0.499524 0.000476
23 0.666034 0.000355 0.333134 0.000476
24 0.000476 0.000355 0.000355 0.998813
25 0.000476 0.333134 0.000355 0.666034
26 0.666034 0.000355 0.333134 0.000476
27 0.000476 0.665913 0.000355 0.333255
28 0.998813 0.000355 0.000355 0.000476
29 0.000476 0.000355 0.998692 0.000476
30 0.166866 0.000355 0.499524 0.333255
31 0.000476 0.333134 0.166745 0.499645
32 0.166866 0.000355 0.333134 0.499645
33 0.166866 0.000355 0.000355 0.832423
34 0.333255 0.000355 0.499524 0.166866
35 0.832423 0.000355 0.000355 0.166866
36 0.000476 0.000355 0.499524 0.499645
37 0.000476 0.665913 0.000355 0.333255
38 0.000476 0.333134 0.000355 0.666034
39 0.998813 0.000355 0.000355 0.000476
40 0.000476 0.665913 0.000355 0.333255
41 0.000476 0.665913 0.000355 0.333255
42 0.000476 0.000355 0.665913 0.333255
43 0.000476 0.166745 0.333134 0.499645
44 0.000476 0.000355 0.333134 0.666034
45 0.333255 0.499524 0.166745 0.000476
46 0.333255 0.665913 0.000355 0.000476
47 0.000476 0.333134 0.000355 0.666034
48 0.333255 0.000355 0.333134 0.333255
49 0.000476 0.499524 0.499524 0.000476
50 0.166866 0.832302 0.000355 0.000476

Motif FASTA
1 gtccacccgc CTCAGCCTCCCAAAGTGCTGGAATTACAGGCTTGAGCCACCGTGCCCAGC aaccatttca
2 atccacccat CTCGGCCTCCTCAAGTGCTGGGATTACAGGTGAGAGCCACTGTGCCTGGC gaagcccatg
3 gcagtcctgc TCCAGCCTCCCAAAGTGCTGGGATTATAGGCATGAGCTACCGCTCCCAGC cccagacatt
4 tccaggaagt CTCAGCGAGCTCACGCCGCGCAGTCGCAGTTTTAATTTATCTGTAATTCC cgcgcttttc
5 tccaggaagt CTCAGCGAGCTCACGCCGCGCAGTCGCAGTTTTAATTTATCTGTAATTCC cgcgcttttc
6 acacggttta TACAGATGTCAATGATGTATTGATTATAGAGGTTTTCTACTGTTGCTGCA tcttattttt


Department of Computer Science and Information Engineering
National Central University
No.300, Jung-Da Rd., Chung-li , Tao-yuan, Taiwan, 320, R.O.C.
Department of Biological Science and Technology, Institute of Bioinformatics
National Chiao Tung University
1001 Ta Hsueh Road, Hsinchu, Taiwan 300, ROC
Contact with bryan@mail.NCTU.edu.tw







Array
(
    [login] => 92
    [mysid] => n603fg6t3403g5f9su9e56the6
    [email] => hcc@db.csie.ncu.edu.tw
)