An integrated system to identify conserved sequence elements
      associated to mRNA splicing



[   MEME   ][   3'-flanking Region (Intronic)   ][   Motif #3   ]

Motif Logos

Motif Energy Dot Plot (25 + 50 + 25)

Motif Secondary Structure ( 25 + 50 + 25)

Motif Statistics  
Gene ID Chromosome Strand Exon
1
Intron
1
Exon
2
Intron
2
Exon
3
Intron
3
Exon
4
Intron
4
Exon
5
Intron
5
Exon
6
Intron
6
Exon
7
Intron
7
Exon
8
Intron
8
Exon
9
Intron
9
Exon
10
Intron
10
Exon
11
Intron
11
Exon
12
Intron
12
Exon
13
Intron
13
Exon
14
Intron
14
Exon
15
Intron
15
Exon
16
Intron
16
Exon
17
Intron
17
Exon
18
Intron
18
Exon
19
Intron
19
Exon
20
Intron
20
Exon
21
Intron
21
Exon
22
Intron
22
Exon
23
Intron
23
Exon
24
Intron
24
Exon
25
Intron
25
Exon
26
 
ENSG00000012048 HMM 17 -1                                                                                                                                                          0/0
Use HMM Models to Scan This Gene Set M-->Motif s-->selected region  

Motif Information
Detail ID Gene ID Chromosome Start Position End Position Strand View ProSplicer Splice View
1 ENSG00000012048  17  41650467 41650516 -1
2 ENSG00000012048  17  41650479 41650528 -1

Motif Simplified PSSM
A 0 0 0 0 0 0 0 0 a 0 a 0 0 0 0 0 0 0 0 0 0 a a 0 0 0 a 0 a 0 0 0 0 0 0 a 0 a 0 a 0 0 0 0 0 0 0 0 0 0
C a a 0 0 0 0 0 a 0 0 0 a 0 0 0 0 0 0 0 a a 0 0 0 a a 0 0 0 0 a a a a 0 0 0 0 0 0 a 0 a 0 0 0 0 a 0 a
G 0 0 a a a a a 0 0 a 0 0 0 a a a 0 a a 0 0 0 0 0 0 0 0 a 0 a 0 0 0 0 a 0 a 0 a 0 0 a 0 0 0 a a 0 0 0
T 0 0 0 0 0 0 0 0 0 0 0 0 a 0 0 0 a 0 0 0 0 0 0 a 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 a a 0 0 0 a 0

Motif PSSM
Position A C G T
1 0.001425 0.996088 0.001063 0.001425
2 0.001425 0.996088 0.001063 0.001425
3 0.001425 0.001063 0.996088 0.001425
4 0.001425 0.001063 0.996088 0.001425
5 0.001425 0.001063 0.996088 0.001425
6 0.001425 0.001063 0.996088 0.001425
7 0.001425 0.001063 0.996088 0.001425
8 0.001425 0.996088 0.001063 0.001425
9 0.99645 0.001063 0.001063 0.001425
10 0.001425 0.001063 0.996088 0.001425
11 0.99645 0.001063 0.001063 0.001425
12 0.001425 0.996088 0.001063 0.001425
13 0.001425 0.001063 0.001063 0.99645
14 0.001425 0.001063 0.996088 0.001425
15 0.001425 0.001063 0.996088 0.001425
16 0.001425 0.001063 0.996088 0.001425
17 0.001425 0.001063 0.001063 0.99645
18 0.001425 0.001063 0.996088 0.001425
19 0.001425 0.001063 0.996088 0.001425
20 0.001425 0.996088 0.001063 0.001425
21 0.001425 0.996088 0.001063 0.001425
22 0.99645 0.001063 0.001063 0.001425
23 0.99645 0.001063 0.001063 0.001425
24 0.001425 0.001063 0.001063 0.99645
25 0.001425 0.996088 0.001063 0.001425
26 0.001425 0.996088 0.001063 0.001425
27 0.99645 0.001063 0.001063 0.001425
28 0.001425 0.001063 0.996088 0.001425
29 0.99645 0.001063 0.001063 0.001425
30 0.001425 0.001063 0.996088 0.001425
31 0.001425 0.996088 0.001063 0.001425
32 0.001425 0.996088 0.001063 0.001425
33 0.001425 0.996088 0.001063 0.001425
34 0.001425 0.996088 0.001063 0.001425
35 0.001425 0.001063 0.996088 0.001425
36 0.99645 0.001063 0.001063 0.001425
37 0.001425 0.001063 0.996088 0.001425
38 0.99645 0.001063 0.001063 0.001425
39 0.001425 0.001063 0.996088 0.001425
40 0.99645 0.001063 0.001063 0.001425
41 0.001425 0.996088 0.001063 0.001425
42 0.001425 0.001063 0.996088 0.001425
43 0.001425 0.996088 0.001063 0.001425
44 0.001425 0.001063 0.001063 0.99645
45 0.001425 0.001063 0.001063 0.99645
46 0.001425 0.001063 0.996088 0.001425
47 0.001425 0.001063 0.996088 0.001425
48 0.001425 0.996088 0.001063 0.001425
49 0.001425 0.001063 0.001063 0.99645
50 0.001425 0.996088 0.001063 0.001425

Motif FASTA
1 tttacgtcat CCGGGGGCAGACTGGGTGGCCAATCCAGAGCCCCGAGAGACGCTTGGCTC tttctgtccc
2 tttacgtcat CCGGGGGCAGACTGGGTGGCCAATCCAGAGCCCCGAGAGACGCTTGGCTC tttctgtccc


Department of Computer Science and Information Engineering
National Central University
No.300, Jung-Da Rd., Chung-li , Tao-yuan, Taiwan, 320, R.O.C.
Department of Biological Science and Technology, Institute of Bioinformatics
National Chiao Tung University
1001 Ta Hsueh Road, Hsinchu, Taiwan 300, ROC
Contact with bryan@mail.NCTU.edu.tw







Array
(
    [login] => 22
    [mysid] => n603fg6t3403g5f9su9e56the6
    [email] => hcc@db.csie.ncu.edu.tw
)