An integrated system to identify conserved sequence elements
      associated to mRNA splicing



[   MEME   ][   User Selected Region (Exonic)   ][   Motif #1   ]

Motif Logos

Motif Energy Dot Plot (25 + 50 + 25)

Motif Secondary Structure ( 25 + 50 + 25)

Motif Statistics  
Gene ID Chromosome Strand Exon
1
Intron
1
Exon
2
Intron
2
Exon
3
Intron
3
Exon
4
Intron
4
Exon
5
Intron
5
Exon
6
Intron
6
Exon
7
Intron
7
Exon
8
Intron
8
Exon
9
Intron
9
Exon
10
Intron
10
Exon
11
Intron
11
Exon
12
Intron
12
Exon
13
Intron
13
Exon
14
Intron
14
Exon
15
Intron
15
Exon
16
Intron
16
Exon
17
Intron
17
Exon
18
Intron
18
Exon
19
Intron
19
Exon
20
Intron
20
Exon
21
Intron
21
Exon
22
Intron
22
Exon
23
Intron
23
Exon
24
Intron
24
Exon
25
Intron
25
Exon
26
 
ENSG00000012048 HMM 17 -1                                                                                                                                                          0/0
Use HMM Models to Scan This Gene Set M-->Motif s-->selected region  

Motif Information
Detail ID Gene ID Chromosome Start Position End Position Strand View ProSplicer Splice View
1 ENSG00000012048  17  41650376 41650425 -1
2 ENSG00000012048  17  41650382 41650431 -1

Motif Simplified PSSM
A 0 0 0 0 0 0 a a a 0 0 0 a 0 a 0 0 0 0 0 0 0 0 a a 0 0 0 a 0 0 0 0 0 0 0 0 0 0 0 a 0 0 0 0 0 0 0 0 0
C a a a 0 0 0 0 0 0 0 0 0 0 a 0 0 0 0 0 0 a a a 0 0 0 0 0 0 0 0 a 0 a 0 0 0 0 0 0 0 a 0 0 0 a 0 0 0 0
G 0 0 0 a a a 0 0 0 a a a 0 0 0 a a a a a 0 0 0 0 0 a 0 a 0 0 a 0 0 0 0 a a a a 0 0 0 0 a a 0 a 0 a a
T 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 a 0 0 a 0 0 a 0 a 0 0 0 0 a 0 0 a 0 0 0 0 a 0 0

Motif PSSM
Position A C G T
1 0.001352 0.996161 0.001136 0.001352
2 0.001352 0.996161 0.001136 0.001352
3 0.001352 0.996161 0.001136 0.001352
4 0.001352 0.001136 0.996161 0.001352
5 0.001352 0.001136 0.996161 0.001352
6 0.001352 0.001136 0.996161 0.001352
7 0.996376 0.001136 0.001136 0.001352
8 0.996376 0.001136 0.001136 0.001352
9 0.996376 0.001136 0.001136 0.001352
10 0.001352 0.001136 0.996161 0.001352
11 0.001352 0.001136 0.996161 0.001352
12 0.001352 0.001136 0.996161 0.001352
13 0.996376 0.001136 0.001136 0.001352
14 0.001352 0.996161 0.001136 0.001352
15 0.996376 0.001136 0.001136 0.001352
16 0.001352 0.001136 0.996161 0.001352
17 0.001352 0.001136 0.996161 0.001352
18 0.001352 0.001136 0.996161 0.001352
19 0.001352 0.001136 0.996161 0.001352
20 0.001352 0.001136 0.996161 0.001352
21 0.001352 0.996161 0.001136 0.001352
22 0.001352 0.996161 0.001136 0.001352
23 0.001352 0.996161 0.001136 0.001352
24 0.996376 0.001136 0.001136 0.001352
25 0.996376 0.001136 0.001136 0.001352
26 0.001352 0.001136 0.996161 0.001352
27 0.001352 0.001136 0.001136 0.996376
28 0.001352 0.001136 0.996161 0.001352
29 0.996376 0.001136 0.001136 0.001352
30 0.001352 0.001136 0.001136 0.996376
31 0.001352 0.001136 0.996161 0.001352
32 0.001352 0.996161 0.001136 0.001352
33 0.001352 0.001136 0.001136 0.996376
34 0.001352 0.996161 0.001136 0.001352
35 0.001352 0.001136 0.001136 0.996376
36 0.001352 0.001136 0.996161 0.001352
37 0.001352 0.001136 0.996161 0.001352
38 0.001352 0.001136 0.996161 0.001352
39 0.001352 0.001136 0.996161 0.001352
40 0.001352 0.001136 0.001136 0.996376
41 0.996376 0.001136 0.001136 0.001352
42 0.001352 0.996161 0.001136 0.001352
43 0.001352 0.001136 0.001136 0.996376
44 0.001352 0.001136 0.996161 0.001352
45 0.001352 0.001136 0.996161 0.001352
46 0.001352 0.996161 0.001136 0.001352
47 0.001352 0.001136 0.996161 0.001352
48 0.001352 0.001136 0.001136 0.996376
49 0.001352 0.001136 0.996161 0.001352
50 0.001352 0.001136 0.996161 0.001352

Motif FASTA
1 gtagtagagt CCCGGGAAAGGGACAGGGGGCCCAAGTGATGCTCTGGGGTACTGGCGTGG gagagtggat
2 gtagtagagt CCCGGGAAAGGGACAGGGGGCCCAAGTGATGCTCTGGGGTACTGGCGTGG gagagtggat


Department of Computer Science and Information Engineering
National Central University
No.300, Jung-Da Rd., Chung-li , Tao-yuan, Taiwan, 320, R.O.C.
Department of Biological Science and Technology, Institute of Bioinformatics
National Chiao Tung University
1001 Ta Hsueh Road, Hsinchu, Taiwan 300, ROC
Contact with bryan@mail.NCTU.edu.tw







Array
(
    [login] => 21
    [mysid] => n603fg6t3403g5f9su9e56the6
    [email] => hcc@db.csie.ncu.edu.tw
)