An integrated system to identify conserved sequence elements
      associated to mRNA splicing



[   MEME   ][   5'-flanking Region (Intronic)   ][   Motif #1   ]

Motif Logos

Motif Energy Dot Plot (25 + 42 + 25)

Motif Secondary Structure ( 25 + 42 + 25)

Motif Statistics  
Gene ID Chromosome Strand Exon
1
Intron
1
Exon
2
Intron
2
Exon
3
Intron
3
Exon
4
Intron
4
Exon
5
Intron
5
Exon
6
Intron
6
Exon
7
Intron
7
Exon
8
Intron
8
Exon
9
Intron
9
Exon
10
Intron
10
Exon
11
Intron
11
Exon
12
Intron
12
Exon
13
Intron
13
Exon
14
Intron
14
Exon
15
Intron
15
Exon
16
Intron
16
Exon
17
Intron
17
Exon
18
Intron
18
Exon
19
Intron
19
Exon
20
Intron
20
Exon
21
Intron
21
Exon
22
Intron
22
Exon
23
Intron
23
Exon
24
Intron
24
Exon
25
Intron
25
Exon
26
 
ENSG00000012048 HMM 17 -1                                                                                                                                                          0/0
Use HMM Models to Scan This Gene Set M-->Motif s-->selected region  

Motif Information
Detail ID Gene ID Chromosome Start Position End Position Strand View ProSplicer Splice View
1 ENSG00000012048  17  41650211 41650252 -1
2 ENSG00000012048  17  41650211 41650252 -1
3 ENSG00000012048  17  41624883 41624924 -1
4 ENSG00000012048  17  41620816 41620857 -1

Motif Simplified PSSM
A 0 0 0 0 7 0 0 0 a 3 0 0 3 a 0 a 0 0 0 0 5 0 0 a 0 0 0 0 a 0 0 0 0 a 0 0 0 0 0 0 0 0
C 0 0 0 a 0 0 0 0 0 0 a a 0 0 0 0 0 7 0 a 0 7 a 0 2 0 0 a 0 a 0 a a 0 0 a a 0 0 0 0 a
G 0 0 a 0 2 a 0 a 0 7 0 0 7 0 a 0 0 0 a 0 5 0 0 0 0 0 a 0 0 0 0 0 0 0 a 0 0 0 a a a 0
T a a 0 0 0 0 a 0 0 0 0 0 0 0 0 0 a 3 0 0 0 3 0 0 7 a 0 0 0 0 a 0 0 0 0 0 0 a 0 0 0 0

Motif PSSM
Position A C G T
1 0.0007 0.000547 0.000547 0.998206
2 0.0007 0.000547 0.000547 0.998206
3 0.0007 0.000547 0.998054 0.0007
4 0.0007 0.998054 0.000547 0.0007
5 0.748829 0.000547 0.249924 0.0007
6 0.0007 0.000547 0.998054 0.0007
7 0.0007 0.000547 0.000547 0.998206
8 0.0007 0.000547 0.998054 0.0007
9 0.998206 0.000547 0.000547 0.0007
10 0.250076 0.000547 0.748677 0.0007
11 0.0007 0.998054 0.000547 0.0007
12 0.0007 0.998054 0.000547 0.0007
13 0.250076 0.000547 0.748677 0.0007
14 0.998206 0.000547 0.000547 0.0007
15 0.0007 0.000547 0.998054 0.0007
16 0.998206 0.000547 0.000547 0.0007
17 0.0007 0.000547 0.000547 0.998206
18 0.0007 0.748677 0.000547 0.250076
19 0.0007 0.000547 0.998054 0.0007
20 0.0007 0.998054 0.000547 0.0007
21 0.499453 0.000547 0.4993 0.0007
22 0.0007 0.748677 0.000547 0.250076
23 0.0007 0.998054 0.000547 0.0007
24 0.998206 0.000547 0.000547 0.0007
25 0.0007 0.249924 0.000547 0.748829
26 0.0007 0.000547 0.000547 0.998206
27 0.0007 0.000547 0.998054 0.0007
28 0.0007 0.998054 0.000547 0.0007
29 0.998206 0.000547 0.000547 0.0007
30 0.0007 0.998054 0.000547 0.0007
31 0.0007 0.000547 0.000547 0.998206
32 0.0007 0.998054 0.000547 0.0007
33 0.0007 0.998054 0.000547 0.0007
34 0.998206 0.000547 0.000547 0.0007
35 0.0007 0.000547 0.998054 0.0007
36 0.0007 0.998054 0.000547 0.0007
37 0.0007 0.998054 0.000547 0.0007
38 0.0007 0.000547 0.000547 0.998206
39 0.0007 0.000547 0.998054 0.0007
40 0.0007 0.000547 0.998054 0.0007
41 0.0007 0.000547 0.998054 0.0007
42 0.0007 0.998054 0.000547 0.0007

Motif FASTA
1 gaggcggagg TTGCAGTGAGCCGAGATCGCGCCATTGCACTCCAGCCTGGGC gacagagcga
2 gaggcggagg TTGCAGTGAGCCGAGATCGCGCCATTGCACTCCAGCCTGGGC gacagagcga
3 gaggtggagg TTGCGGTGAACCGAGATCGCACCATTGCACTCCAGCCTGGGC aaaaatagcg
4 gaggtggagg TTGCAGTGAGCCAAGATTGCATCACTGCACTCCAGCCTGGGC aacagagtga


Department of Computer Science and Information Engineering
National Central University
No.300, Jung-Da Rd., Chung-li , Tao-yuan, Taiwan, 320, R.O.C.
Department of Biological Science and Technology, Institute of Bioinformatics
National Chiao Tung University
1001 Ta Hsueh Road, Hsinchu, Taiwan 300, ROC
Contact with bryan@mail.NCTU.edu.tw







Array
(
    [login] => 13
    [mysid] => n603fg6t3403g5f9su9e56the6
    [email] => hcc@db.csie.ncu.edu.tw
)