An integrated system to identify conserved sequence elements
      associated to mRNA splicing



[   MEME   ][   5'-flanking Region (Intronic)   ][   Motif #2   ]

Motif Logos

Motif Energy Dot Plot (25 + 50 + 25)

Motif Secondary Structure ( 25 + 50 + 25)

Motif Statistics  
Gene ID Chromosome Strand Exon
1
Intron
1
Exon
2
Intron
2
Exon
3
Intron
3
Exon
4
Intron
4
Exon
5
Intron
5
Exon
6
Intron
6
Exon
7
Intron
7
Exon
8
Intron
8
Exon
9
Intron
9
Exon
10
Intron
10
Exon
11
Intron
11
Exon
12
Intron
12
Exon
13
Intron
13
Exon
14
Intron
14
Exon
15
Intron
15
Exon
16
Intron
16
Exon
17
Intron
17
Exon
18
Intron
18
Exon
19
Intron
19
Exon
20
Intron
20
Exon
21
Intron
21
Exon
22
Intron
22
Exon
23
Intron
23
Exon
24
Intron
24
Exon
25
Intron
25
Exon
26
 
ENSG00000012048 HMM 17 -1                                                                                                                                                          0/0
Use HMM Models to Scan This Gene Set M-->Motif s-->selected region  

Motif Information
Detail ID Gene ID Chromosome Start Position End Position Strand View ProSplicer Splice View
1 ENSG00000012048  17  41650077 41650126 -1
2 ENSG00000012048  17  41650077 41650126 -1
3 ENSG00000012048  17  41628980 41629029 -1
4 ENSG00000012048  17  41624738 41624787 -1
5 ENSG00000012048  17  41620953 41621002 -1

Motif Simplified PSSM
A 0 a 0 0 0 0 0 a 0 a 0 0 a 0 0 0 0 2 4 0 0 a a 0 6 0 0 2 2 0 a a a 0 0 0 0 2 0 0 0 0 0 a 0 2 a a a 8
C 0 0 0 0 0 8 4 0 0 0 a a 0 0 a a 0 2 0 8 8 0 0 a 0 0 0 0 0 0 0 0 0 a 4 a 8 0 0 a 0 8 0 0 8 2 0 0 0 2
G a 0 a 0 0 0 6 0 a 0 0 0 0 a 0 0 0 6 6 2 0 0 0 0 4 0 a 8 0 a 0 0 0 0 0 0 0 8 0 0 0 2 0 0 0 0 0 0 0 0
T 0 0 0 a a 2 0 0 0 0 0 0 0 0 0 0 a 0 0 0 2 0 0 0 0 a 0 0 8 0 0 0 0 0 6 0 2 0 a 0 a 0 a 0 2 6 0 0 0 0

Motif PSSM
Position A C G T
1 0.00056 0.000438 0.998442 0.00056
2 0.998564 0.000438 0.000438 0.00056
3 0.00056 0.000438 0.998442 0.00056
4 0.00056 0.000438 0.000438 0.998564
5 0.00056 0.000438 0.000438 0.998564
6 0.00056 0.798841 0.000438 0.200161
7 0.00056 0.39964 0.59924 0.00056
8 0.998564 0.000438 0.000438 0.00056
9 0.00056 0.000438 0.998442 0.00056
10 0.998564 0.000438 0.000438 0.00056
11 0.00056 0.998442 0.000438 0.00056
12 0.00056 0.998442 0.000438 0.00056
13 0.998564 0.000438 0.000438 0.00056
14 0.00056 0.000438 0.998442 0.00056
15 0.00056 0.998442 0.000438 0.00056
16 0.00056 0.998442 0.000438 0.00056
17 0.00056 0.000438 0.000438 0.998564
18 0.200161 0.200039 0.59924 0.00056
19 0.399762 0.000438 0.59924 0.00056
20 0.00056 0.798841 0.200039 0.00056
21 0.00056 0.798841 0.000438 0.200161
22 0.998564 0.000438 0.000438 0.00056
23 0.998564 0.000438 0.000438 0.00056
24 0.00056 0.998442 0.000438 0.00056
25 0.599362 0.000438 0.39964 0.00056
26 0.00056 0.000438 0.000438 0.998564
27 0.00056 0.000438 0.998442 0.00056
28 0.200161 0.000438 0.798841 0.00056
29 0.200161 0.000438 0.000438 0.798963
30 0.00056 0.000438 0.998442 0.00056
31 0.998564 0.000438 0.000438 0.00056
32 0.998564 0.000438 0.000438 0.00056
33 0.998564 0.000438 0.000438 0.00056
34 0.00056 0.998442 0.000438 0.00056
35 0.00056 0.39964 0.000438 0.599362
36 0.00056 0.998442 0.000438 0.00056
37 0.00056 0.798841 0.000438 0.200161
38 0.200161 0.000438 0.798841 0.00056
39 0.00056 0.000438 0.000438 0.998564
40 0.00056 0.998442 0.000438 0.00056
41 0.00056 0.000438 0.000438 0.998564
42 0.00056 0.798841 0.200039 0.00056
43 0.00056 0.000438 0.000438 0.998564
44 0.998564 0.000438 0.000438 0.00056
45 0.00056 0.798841 0.000438 0.200161
46 0.200161 0.200039 0.000438 0.599362
47 0.998564 0.000438 0.000438 0.00056
48 0.998564 0.000438 0.000438 0.00056
49 0.998564 0.000438 0.000438 0.00056
50 0.798963 0.200039 0.000438 0.00056

Motif FASTA
1 atgaggtcag GAGTTCCAGACCAGCCTGACCAACGTGGTGAAACTCCGTCTCTACTAAAA atacaaaaat
2 atgaggtcag GAGTTCCAGACCAGCCTGACCAACGTGGTGAAACTCCGTCTCTACTAAAA atacaaaaat
3 ctgaggttag GAGTTCGAGACCAGCCTGGCCAACATGATGAAACCCCGTCTCTACTAAAA atacaaaaat
4 ctgaggtcgg GAGTTCGAGACCAGCCTAGCCAACATGGAGAAACTCTGTCTGTACCAAAA aataaaaaat
5 ttgagtccag GAGTTTGAGACCAGCCTCGGTAACATGGTGAAACCCCATCTCTATAAAAC cacaaaaaat


Department of Computer Science and Information Engineering
National Central University
No.300, Jung-Da Rd., Chung-li , Tao-yuan, Taiwan, 320, R.O.C.
Department of Biological Science and Technology, Institute of Bioinformatics
National Chiao Tung University
1001 Ta Hsueh Road, Hsinchu, Taiwan 300, ROC
Contact with bryan@mail.NCTU.edu.tw







Array
(
    [login] => 98
    [mysid] => n603fg6t3403g5f9su9e56the6
    [email] => hcc@db.csie.ncu.edu.tw
)