An integrated system to identify conserved sequence elements
      associated to mRNA splicing

[   MEME   ][   3'-flanking Region (Intronic)   ][   Motif #3   ]

Motif Logos

Motif Energy Dot Plot (25 + 21 + 25)

Motif Secondary Structure ( 25 + 21 + 25)

Motif Statistics  
Gene ID Chromosome Strand Exon
ENSG00000001626 HMM 7 1     s                                               M s                                                                                                           1/2=0.5
ENSG00000012048 HMM 17 -1                                                                                                                                                          0/0
ENSG00000017427 HMM 12 -1                    s  M            1/1=1
ENSG00000101017 HMM 20 1                                                    0/0
ENSG00000127603 HMM 1 1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            0/0
ENSG00000131828 HMM X 1                                                                0/0
ENSG00000139618 HMM 13 1                                                                                                                                                                      0/0
ENSG00000140443 HMM 15 1           s                                                                                                                 0/1
Use HMM Models to Scan This Gene Set M-->Motif s-->selected region  

Motif Information
Detail ID Gene ID Chromosome Start Position End Position Strand View ProSplicer Splice View
1 ENSG00000131828  18735308 18735328 1
2 ENSG00000131828  18735308 18735328 1
3 ENSG00000017427  12  101372208 101372228 -1
4 ENSG00000101017  20  45437340 45437360 1
5 ENSG00000001626  116782463 116782483 1

Motif Simplified PSSM
A 0 0 0 0 8 4 6 0 0 0 2 0 2 0 2 0 0 0 0 4 0
C a 0 a 0 2 2 0 0 8 8 4 2 8 0 0 0 2 a 0 0 0
G 0 0 0 0 0 0 0 a 2 0 0 0 0 0 8 4 6 0 0 6 6
T 0 a 0 a 0 4 4 0 0 2 4 8 0 a 0 6 2 0 a 0 4

Motif PSSM
Position A C G T
1 0.000559 0.998443 0.000439 0.000559
2 0.000559 0.000439 0.000439 0.998563
3 0.000559 0.998443 0.000439 0.000559
4 0.000559 0.000439 0.000439 0.998563
5 0.798962 0.20004 0.000439 0.000559
6 0.399761 0.20004 0.000439 0.399761
7 0.599362 0.000439 0.000439 0.399761
8 0.000559 0.000439 0.998443 0.000559
9 0.000559 0.798842 0.20004 0.000559
10 0.000559 0.798842 0.000439 0.20016
11 0.20016 0.39964 0.000439 0.399761
12 0.000559 0.20004 0.000439 0.798962
13 0.20016 0.798842 0.000439 0.000559
14 0.000559 0.000439 0.000439 0.998563
15 0.20016 0.000439 0.798842 0.000559
16 0.000559 0.000439 0.39964 0.599362
17 0.000559 0.20004 0.599241 0.20016
18 0.000559 0.998443 0.000439 0.000559
19 0.000559 0.000439 0.000439 0.998563
20 0.399761 0.000439 0.599241 0.000559
21 0.000559 0.000439 0.599241 0.399761

1 gaaggtaagg CTCTAAAGCCCTCTGGGCTAG tgacatttat
3 ttctcatgta CTCTATTGGCTTCTGTGCTGG gtagtcctga
4 tgcctccatt CTCTCCAGCCACCTGTCCTGT ccctgctccc
5 acagacattt CTCTATTGCTTTATATTCTGT ttctggaatt

Department of Computer Science and Information Engineering
National Central University
No.300, Jung-Da Rd., Chung-li , Tao-yuan, Taiwan, 320, R.O.C.
Department of Biological Science and Technology, Institute of Bioinformatics
National Chiao Tung University
1001 Ta Hsueh Road, Hsinchu, Taiwan 300, ROC
Contact with

    [login] => 11
    [mysid] => n603fg6t3403g5f9su9e56the6
    [email] =>